Incidental Mutation 'RF018:Vmn2r23'
ID 603670
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # RF018 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 123679780-123719198 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 123690075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 317 (L317R)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: L317R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L317R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,891,293 (GRCm39) probably benign Het
Abca15 T A 7: 119,993,683 (GRCm39) V1301E possibly damaging Het
Adcy10 T A 1: 165,379,678 (GRCm39) V980E probably damaging Het
Aldh1a2 T C 9: 71,192,552 (GRCm39) V469A probably damaging Het
Alk T A 17: 72,256,808 (GRCm39) T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,693,965 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,162,674 (GRCm39) probably null Het
Btnl10 CAAA CAAAAAA 11: 58,814,752 (GRCm39) probably benign Het
Ccdc81 C A 7: 89,515,906 (GRCm39) probably null Het
Cd209g A G 8: 4,187,398 (GRCm39) Y194C probably benign Het
Cenpc1 A T 5: 86,193,228 (GRCm39) S220R possibly damaging Het
Ddx42 A T 11: 106,123,630 (GRCm39) probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,894,398 (GRCm39) probably null Het
Eif5b A T 1: 38,060,673 (GRCm39) probably null Het
Ell2 C A 13: 75,911,727 (GRCm39) H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,489,106 (GRCm39) probably null Het
Gnat2 T C 3: 108,003,645 (GRCm39) S107P unknown Het
Guk1 T A 11: 59,077,234 (GRCm39) D70V probably benign Het
Itpkb C T 1: 180,160,887 (GRCm39) R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,019,974 (GRCm39) probably benign Het
Lamp3 A C 16: 19,520,000 (GRCm39) I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 75,184,995 (GRCm39) probably null Het
Lrp1b C T 2: 41,000,919 (GRCm39) E2216K Het
Lrrc27 A G 7: 138,806,016 (GRCm39) D227G probably benign Het
Lrrk1 C T 7: 66,031,250 (GRCm39) G16E possibly damaging Het
Lrrtm1 T A 6: 77,221,334 (GRCm39) S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,281,058 (GRCm39) probably benign Het
Mamld1 CAG CAGAAG X: 70,162,455 (GRCm39) probably benign Het
Mpo G C 11: 87,688,465 (GRCm39) A375P probably damaging Het
Myo9a A G 9: 59,776,869 (GRCm39) H1089R probably benign Het
Nalf2 CGCCGC CGCCGCTGCCGC X: 98,864,967 (GRCm39) probably benign Het
Ndufc2 T C 7: 97,056,228 (GRCm39) *109Q probably null Het
Nudt16 A T 9: 105,008,898 (GRCm39) Y28N probably damaging Het
Nudt4 A T 10: 95,385,675 (GRCm39) probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,458,059 (GRCm39) probably benign Het
Or2ag15 T A 7: 106,340,692 (GRCm39) I150F probably benign Het
P2ry12 T A 3: 59,124,833 (GRCm39) T281S probably benign Het
P4ha2 TGTTGG T 11: 54,001,072 (GRCm39) probably null Het
Pcnx2 A G 8: 126,604,258 (GRCm39) V666A probably damaging Het
Pde6a T A 18: 61,364,475 (GRCm39) I177N possibly damaging Het
Pgm1 A T 4: 99,819,500 (GRCm39) probably null Het
Plce1 T A 19: 38,705,651 (GRCm39) W1019R probably damaging Het
Plch1 C A 3: 63,628,636 (GRCm39) K542N probably damaging Het
Plekhj1 T C 10: 80,632,471 (GRCm39) Q113R not run Het
Postn A T 3: 54,291,913 (GRCm39) I705F probably damaging Het
Ppp1r15b G T 1: 133,059,352 (GRCm39) probably benign Het
Prkab1 T C 5: 116,159,689 (GRCm39) E59G probably damaging Het
Qrfprl T A 6: 65,433,174 (GRCm39) Y331* probably null Het
Raph1 GG GGGGG 1: 60,528,426 (GRCm39) probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,756,788 (GRCm39) probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,364,013 (GRCm39) probably benign Het
Ros1 T A 10: 52,031,217 (GRCm39) M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,209,343 (GRCm39) probably null Het
Sectm1b A G 11: 120,945,756 (GRCm39) V195A probably benign Het
Sirpa TCATCAG T 2: 129,451,123 (GRCm39) probably null Het
Slc28a1 T A 7: 80,819,032 (GRCm39) probably null Het
Sphk1 G C 11: 116,425,771 (GRCm39) S42T possibly damaging Het
Spta1 T C 1: 174,036,885 (GRCm39) L1132P probably damaging Het
Srrt A T 5: 137,298,262 (GRCm39) N303K probably benign Het
Ssh2 A G 11: 77,344,880 (GRCm39) E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,984,712 (GRCm39) probably null Het
Tchhl1 T C 3: 93,377,691 (GRCm39) F132L probably benign Het
Tex14 A G 11: 87,405,572 (GRCm39) E828G probably benign Het
Tfeb CAG CAGGAG 17: 48,097,020 (GRCm39) probably benign Het
Tmtc1 T C 6: 148,149,009 (GRCm39) Y699C probably damaging Het
Ubn1 A G 16: 4,882,256 (GRCm39) Y239C probably damaging Het
Vmn2r78 C T 7: 86,603,639 (GRCm39) R606* probably null Het
Vps72 T G 3: 95,028,719 (GRCm39) probably null Het
Zc3h11a A G 1: 133,554,853 (GRCm39) S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,013,452 (GRCm39) probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,899,745 (GRCm39) probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,923,948 (GRCm39) probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123,706,684 (GRCm39) missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123,706,555 (GRCm39) missense probably benign
IGL01073:Vmn2r23 APN 6 123,689,759 (GRCm39) missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123,681,383 (GRCm39) missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123,681,366 (GRCm39) missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123,718,845 (GRCm39) missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123,718,819 (GRCm39) missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123,718,703 (GRCm39) missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123,718,795 (GRCm39) missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123,681,437 (GRCm39) missense probably benign
IGL02831:Vmn2r23 APN 6 123,681,344 (GRCm39) missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123,681,355 (GRCm39) missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123,718,578 (GRCm39) missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123,718,741 (GRCm39) missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123,681,333 (GRCm39) missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123,706,585 (GRCm39) missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123,706,680 (GRCm39) missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123,719,094 (GRCm39) missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123,718,963 (GRCm39) missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123,690,229 (GRCm39) nonsense probably null
R1629:Vmn2r23 UTSW 6 123,690,386 (GRCm39) missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123,706,649 (GRCm39) missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123,679,874 (GRCm39) missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123,689,969 (GRCm39) missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123,718,458 (GRCm39) missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123,681,384 (GRCm39) missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123,719,147 (GRCm39) nonsense probably null
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123,690,123 (GRCm39) missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123,690,129 (GRCm39) missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123,718,348 (GRCm39) missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123,706,697 (GRCm39) missense probably benign
R4506:Vmn2r23 UTSW 6 123,679,884 (GRCm39) missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123,718,689 (GRCm39) missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123,718,785 (GRCm39) missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123,710,308 (GRCm39) missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123,689,936 (GRCm39) missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123,689,961 (GRCm39) missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123,690,410 (GRCm39) missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123,690,033 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R5761:Vmn2r23 UTSW 6 123,689,718 (GRCm39) missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123,689,901 (GRCm39) missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123,718,854 (GRCm39) missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123,681,359 (GRCm39) missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123,689,861 (GRCm39) missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123,690,384 (GRCm39) missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123,710,232 (GRCm39) missense probably benign
R6925:Vmn2r23 UTSW 6 123,681,512 (GRCm39) missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123,689,981 (GRCm39) missense probably benign
R7215:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123,718,540 (GRCm39) missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123,681,538 (GRCm39) missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123,681,500 (GRCm39) missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123,718,312 (GRCm39) missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123,681,599 (GRCm39) missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123,718,615 (GRCm39) missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123,690,431 (GRCm39) missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123,679,991 (GRCm39) missense
R8966:Vmn2r23 UTSW 6 123,719,079 (GRCm39) missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123,719,038 (GRCm39) missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123,718,782 (GRCm39) missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123,681,323 (GRCm39) missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123,710,352 (GRCm39) missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123,689,672 (GRCm39) missense probably benign 0.30
T0975:Vmn2r23 UTSW 6 123,690,120 (GRCm39) missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123,719,067 (GRCm39) missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123,706,684 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACGAACCATGGACTTTGTG -3'
(R):5'- AGTTCCCTGATCCCATGCTG -3'

Sequencing Primer
(F):5'- AGGTTCCAGAATTTCCTGCTAAGG -3'
(R):5'- CCCATGCTGTTCAAAATATGGAC -3'
Posted On 2019-12-04