Incidental Mutation 'RF018:Vmn2r23'
ID603670
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #RF018 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 123713116 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 317 (L317R)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: L317R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: L317R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Alk T A 17: 71,949,813 T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,762,166 probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,042,253 probably benign Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrc27 A G 7: 139,226,100 D227G probably benign Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,390,232 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,627,578 probably benign Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,608,929 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Srrt A T 5: 137,300,000 N303K probably benign Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,677,283 probably null Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tfeb CAG CAGGAG 17: 47,786,095 probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACGAACCATGGACTTTGTG -3'
(R):5'- AGTTCCCTGATCCCATGCTG -3'

Sequencing Primer
(F):5'- AGGTTCCAGAATTTCCTGCTAAGG -3'
(R):5'- CCCATGCTGTTCAAAATATGGAC -3'
Posted On2019-12-04