Incidental Mutation 'RF018:Lrrc27'
ID603680
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Nameleucine rich repeat containing 27
Synonyms1700071K18Rik, 2310044E02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #RF018 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139212988-139242979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139226100 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 227 (D227G)
Ref Sequence ENSEMBL: ENSMUSP00000016124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124] [ENSMUST00000106104] [ENSMUST00000135509]
Predicted Effect probably benign
Transcript: ENSMUST00000016124
AA Change: D227G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106104
AA Change: D227G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101710
Gene: ENSMUSG00000015980
AA Change: D227G

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135509
SMART Domains Protein: ENSMUSP00000116827
Gene: ENSMUSG00000015980

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Alk T A 17: 71,949,813 T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Ccdc81 C A 7: 89,866,698 probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,762,166 probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,042,253 probably benign Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,390,232 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nudt4 A T 10: 95,549,813 probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,627,578 probably benign Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Pgm2 A T 4: 99,962,303 probably null Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Ppp1r15b G T 1: 133,131,614 probably benign Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,608,929 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Slc28a1 T A 7: 81,169,284 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Srrt A T 5: 137,300,000 N303K probably benign Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,677,283 probably null Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tfeb CAG CAGGAG 17: 47,786,095 probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r23 T G 6: 123,713,116 L317R probably benign Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 139227911 intron probably benign
IGL02095:Lrrc27 APN 7 139230253 missense probably benign 0.04
IGL02489:Lrrc27 APN 7 139226061 missense probably benign 0.01
IGL03080:Lrrc27 APN 7 139230237 missense probably benign 0.03
R0372:Lrrc27 UTSW 7 139226187 missense probably benign 0.17
R1466:Lrrc27 UTSW 7 139230308 unclassified probably benign
R2401:Lrrc27 UTSW 7 139223613 missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 139228684 intron probably benign
R3113:Lrrc27 UTSW 7 139218307 missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 139223693 missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R4784:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R5070:Lrrc27 UTSW 7 139214799 missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 139218335 unclassified probably benign
R6408:Lrrc27 UTSW 7 139218268 missense probably benign 0.14
R6993:Lrrc27 UTSW 7 139242624 missense probably damaging 0.99
R7332:Lrrc27 UTSW 7 139242745 missense probably damaging 1.00
R7350:Lrrc27 UTSW 7 139226106 missense probably benign 0.01
R7460:Lrrc27 UTSW 7 139223658 missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 139214832 missense probably benign
R8020:Lrrc27 UTSW 7 139236877 missense probably damaging 1.00
R8071:Lrrc27 UTSW 7 139236986 missense probably benign 0.01
R8518:Lrrc27 UTSW 7 139228774 missense probably benign 0.01
X0065:Lrrc27 UTSW 7 139230245 missense probably benign 0.00
X0065:Lrrc27 UTSW 7 139230246 missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 139242720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACTGGCCACTGCTGTAG -3'
(R):5'- ATTTGGCGGCAGCTCAACAG -3'

Sequencing Primer
(F):5'- AGATGAACTCTGGTGCTCAGCTATC -3'
(R):5'- TTACTGGGCCATATCTCG -3'
Posted On2019-12-04