Incidental Mutation 'RF018:Tfeb'
ID603708
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Nametranscription factor EB
SynonymsbHLHe35, TFEB, Tcfeb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF018 (G1)
Quality Score121.467
Status Not validated
Chromosome17
Chromosomal Location47737030-47792419 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGGAG at 47786095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
Predicted Effect probably benign
Transcript: ENSMUST00000024786
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113284
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146782
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Alk T A 17: 71,949,813 T684S probably benign Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Ccdc81 C A 7: 89,866,698 probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,762,166 probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,042,253 probably benign Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrc27 A G 7: 139,226,100 D227G probably benign Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,390,232 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nudt4 A T 10: 95,549,813 probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,627,578 probably benign Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Pgm2 A T 4: 99,962,303 probably null Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Ppp1r15b G T 1: 133,131,614 probably benign Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,608,929 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Slc28a1 T A 7: 81,169,284 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Srrt A T 5: 137,300,000 N303K probably benign Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,677,283 probably null Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r23 T G 6: 123,713,116 L317R probably benign Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 47791664 missense probably benign 0.10
IGL03248:Tfeb APN 17 47786995 missense probably benign
IGL03280:Tfeb APN 17 47785937 missense probably benign
FR4304:Tfeb UTSW 17 47786094 small insertion probably benign
FR4976:Tfeb UTSW 17 47786094 small insertion probably benign
R0414:Tfeb UTSW 17 47788299 splice site probably null
R1712:Tfeb UTSW 17 47788986 critical splice donor site probably null
R2014:Tfeb UTSW 17 47791559 missense probably damaging 0.97
R2101:Tfeb UTSW 17 47789665 missense probably damaging 1.00
R4283:Tfeb UTSW 17 47789774 missense probably damaging 1.00
R4734:Tfeb UTSW 17 47785862 missense probably benign 0.33
R4785:Tfeb UTSW 17 47788227 splice site probably null
R4948:Tfeb UTSW 17 47785979 missense probably benign 0.00
R5896:Tfeb UTSW 17 47759508 critical splice donor site probably null
R6522:Tfeb UTSW 17 47789702 missense probably damaging 1.00
R6804:Tfeb UTSW 17 47789810 critical splice donor site probably null
R6836:Tfeb UTSW 17 47786198 critical splice donor site probably null
R6923:Tfeb UTSW 17 47786983 missense probably benign 0.11
RF002:Tfeb UTSW 17 47786102 small insertion probably benign
RF003:Tfeb UTSW 17 47788078 missense possibly damaging 0.86
RF006:Tfeb UTSW 17 47786113 small insertion probably benign
RF008:Tfeb UTSW 17 47786102 small insertion probably benign
RF010:Tfeb UTSW 17 47786094 small insertion probably benign
RF010:Tfeb UTSW 17 47786107 small insertion probably benign
RF022:Tfeb UTSW 17 47786094 small insertion probably benign
RF025:Tfeb UTSW 17 47786088 small insertion probably benign
RF028:Tfeb UTSW 17 47786097 small insertion probably benign
RF030:Tfeb UTSW 17 47786111 small insertion probably benign
RF030:Tfeb UTSW 17 47786112 small insertion probably benign
RF030:Tfeb UTSW 17 47786113 small insertion probably benign
RF034:Tfeb UTSW 17 47786097 small insertion probably benign
RF034:Tfeb UTSW 17 47786098 nonsense probably null
RF035:Tfeb UTSW 17 47786111 small insertion probably benign
RF036:Tfeb UTSW 17 47786103 small insertion probably benign
RF038:Tfeb UTSW 17 47786105 small insertion probably benign
RF038:Tfeb UTSW 17 47786112 small insertion probably benign
RF039:Tfeb UTSW 17 47786095 small insertion probably benign
RF039:Tfeb UTSW 17 47786110 nonsense probably null
RF040:Tfeb UTSW 17 47786097 small insertion probably benign
RF040:Tfeb UTSW 17 47786110 small insertion probably benign
RF040:Tfeb UTSW 17 47786111 small insertion probably benign
RF040:Tfeb UTSW 17 47786112 small insertion probably benign
RF041:Tfeb UTSW 17 47786100 small insertion probably benign
RF042:Tfeb UTSW 17 47786097 small insertion probably benign
RF047:Tfeb UTSW 17 47786106 small insertion probably benign
RF047:Tfeb UTSW 17 47786116 small insertion probably benign
RF053:Tfeb UTSW 17 47786114 small insertion probably benign
RF054:Tfeb UTSW 17 47786098 nonsense probably null
RF060:Tfeb UTSW 17 47786106 small insertion probably benign
RF061:Tfeb UTSW 17 47786092 small insertion probably benign
RF062:Tfeb UTSW 17 47786100 small insertion probably benign
Z1177:Tfeb UTSW 17 47786524 nonsense probably null
Z1177:Tfeb UTSW 17 47791644 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTGCTTAAAGACTACGAAGATGATG -3'
(R):5'- GAACCTTCTGATGCTGGGAC -3'

Sequencing Primer
(F):5'- TGAATACTTCATGGGCCTGTC -3'
(R):5'- TTCTCCAGGTAGGACTGCAC -3'
Posted On2019-12-04