Incidental Mutation 'RF018:Alk'
ID603709
Institutional Source Beutler Lab
Gene Symbol Alk
Ensembl Gene ENSMUSG00000055471
Gene Nameanaplastic lymphoma kinase
SynonymsCD246, Tcrz
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #RF018 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location71869442-72603709 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71949813 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 684 (T684S)
Ref Sequence ENSEMBL: ENSMUSP00000083840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086639]
Predicted Effect probably benign
Transcript: ENSMUST00000086639
AA Change: T684S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: T684S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 99 109 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:MAM 270 431 5.6e-10 PFAM
LDLa 441 477 5.59e-3 SMART
Pfam:MAM 484 640 5.6e-22 PFAM
Pfam:Gly_rich 730 996 8.6e-19 PFAM
low complexity region 1037 1057 N/A INTRINSIC
TyrKc 1120 1387 2.76e-140 SMART
low complexity region 1440 1480 N/A INTRINSIC
low complexity region 1551 1570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGCTGCT GTGGCTGCTTTGGCTGCT 1: 82,913,572 probably benign Het
Abca15 T A 7: 120,394,460 V1301E possibly damaging Het
Adcy10 T A 1: 165,552,109 V980E probably damaging Het
Aldh1a2 T C 9: 71,285,270 V469A probably damaging Het
Ankhd1 GGCGGC GGCGGCAGCGGC 18: 36,560,912 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Blm CCTCCTCC CCTCCTCCTCCTACTCCTCC 7: 80,512,926 probably null Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
C130060K24Rik T A 6: 65,456,190 Y331* probably null Het
Ccdc81 C A 7: 89,866,698 probably null Het
Cd209g A G 8: 4,137,398 Y194C probably benign Het
Cenpc1 A T 5: 86,045,369 S220R possibly damaging Het
Ddx42 A T 11: 106,232,804 probably null Het
Dock4 GTGCCGGTGCCCGT G 12: 40,844,399 probably null Het
Eif5b A T 1: 38,021,592 probably null Het
Ell2 C A 13: 75,763,608 H338N probably damaging Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACGCACTCCTGGTGT 17: 23,762,166 probably null Het
Gm8369 GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 19: 11,511,742 probably null Het
Gnat2 T C 3: 108,096,329 S107P unknown Het
Guk1 T A 11: 59,186,408 D70V probably benign Het
Itpkb C T 1: 180,333,322 R338W probably damaging Het
Krtap28-10 ACCACAGCCACAGCCACCACAGCCACAGCC ACCACAGCCACAGCCCCCACAGCCACAGCCACCACAGCCACAGCC 1: 83,042,253 probably benign Het
Lamp3 A C 16: 19,701,250 I61R probably benign Het
Lrch1 GCTGGTGGTGT G 14: 74,947,555 probably null Het
Lrp1b C T 2: 41,110,907 E2216K Het
Lrrc27 A G 7: 139,226,100 D227G probably benign Het
Lrrk1 C T 7: 66,381,502 G16E possibly damaging Het
Lrrtm1 T A 6: 77,244,351 S264T possibly damaging Het
Lypd8 CCAATCACCAACA CCAATCACCAACAGTTTCCTCGCCTCTGTTACCCCACCAATCACCAACA 11: 58,390,232 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,849 probably benign Het
Mpo G C 11: 87,797,639 A375P probably damaging Het
Myo9a A G 9: 59,869,586 H1089R probably benign Het
Ndufc2 T C 7: 97,407,021 *109Q probably null Het
Nudt16 A T 9: 105,131,699 Y28N probably damaging Het
Nudt4 A T 10: 95,549,813 probably null Het
Nusap1 AGATACACGTTAGCAGTGAGGAGCAAGCTG AGATACACGTTAGCAGTGAGGAGCAAGCTGCGATACACGTTAGCAGTGAGGAGCAAGCTG 2: 119,627,578 probably benign Het
Olfr697 T A 7: 106,741,485 I150F probably benign Het
P2ry12 T A 3: 59,217,412 T281S probably benign Het
P4ha2 TGTTGG T 11: 54,110,246 probably null Het
Pcnx2 A G 8: 125,877,519 V666A probably damaging Het
Pde6a T A 18: 61,231,403 I177N possibly damaging Het
Pgm2 A T 4: 99,962,303 probably null Het
Plce1 T A 19: 38,717,207 W1019R probably damaging Het
Plch1 C A 3: 63,721,215 K542N probably damaging Het
Plekhj1 T C 10: 80,796,637 Q113R not run Het
Postn A T 3: 54,384,492 I705F probably damaging Het
Ppp1r15b G T 1: 133,131,614 probably benign Het
Prkab1 T C 5: 116,021,630 E59G probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rassf6 AGCAATGGGGATTC AGCAATGGGGATTCTGCCTCACTCATGGTCCTGTAGCGCAATGGGGATTC 5: 90,608,929 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCTCACTC 12: 26,314,014 probably benign Het
Ros1 T A 10: 52,155,121 M484L probably benign Het
Rpa1 GCTGCTGCC GC 11: 75,318,517 probably null Het
Sectm1b A G 11: 121,054,930 V195A probably benign Het
Sirpa TCATCAG T 2: 129,609,203 probably null Het
Slc28a1 T A 7: 81,169,284 probably null Het
Sphk1 G C 11: 116,534,945 S42T possibly damaging Het
Spta1 T C 1: 174,209,319 L1132P probably damaging Het
Srrt A T 5: 137,300,000 N303K probably benign Het
Ssh2 A G 11: 77,454,054 E955G probably damaging Het
Strn CCAGTC CCAGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCACAGTC 17: 78,677,283 probably null Het
Tchhl1 T C 3: 93,470,384 F132L probably benign Het
Tex14 A G 11: 87,514,746 E828G probably benign Het
Tfeb CAG CAGGAG 17: 47,786,095 probably benign Het
Tmem28 CGCCGC CGCCGCTGCCGC X: 99,821,361 probably benign Het
Tmtc1 T C 6: 148,247,511 Y699C probably damaging Het
Ubn1 A G 16: 5,064,392 Y239C probably damaging Het
Vmn2r23 T G 6: 123,713,116 L317R probably benign Het
Vmn2r78 C T 7: 86,954,431 R606* probably null Het
Vps72 T G 3: 95,121,408 probably null Het
Zc3h11a A G 1: 133,627,115 S376P possibly damaging Het
Zfp384 GCCCAGGC GCCCAGGCCCAGTCCCAGGC 6: 125,036,489 probably benign Het
Zfp598 CAACCAC CAACCACAACCAC 17: 24,680,771 probably benign Het
Zfp628 TACTCCTCCACCC T 7: 4,920,949 probably benign Het
Other mutations in Alk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Alk APN 17 71895748 missense probably damaging 1.00
IGL00796:Alk APN 17 71905142 missense possibly damaging 0.88
IGL01096:Alk APN 17 71921896 missense possibly damaging 0.87
IGL01367:Alk APN 17 71900786 missense probably damaging 1.00
IGL01402:Alk APN 17 71874178 missense probably damaging 1.00
IGL01652:Alk APN 17 72603531 missense probably damaging 1.00
IGL01717:Alk APN 17 72603382 missense probably benign
IGL02301:Alk APN 17 71874176 missense probably damaging 0.99
IGL02403:Alk APN 17 71901393 missense probably damaging 1.00
IGL02452:Alk APN 17 71902625 nonsense probably null
IGL02724:Alk APN 17 71985460 missense probably benign 0.00
IGL02826:Alk APN 17 71869536 missense probably damaging 1.00
IGL02863:Alk APN 17 71897835 missense probably damaging 1.00
IGL02994:Alk APN 17 71949820 missense probably benign 0.00
IGL03329:Alk APN 17 71899164 splice site probably benign
PIT4382001:Alk UTSW 17 71949921 missense probably benign
R0157:Alk UTSW 17 71949845 missense probably benign 0.00
R0211:Alk UTSW 17 72603516 missense probably damaging 1.00
R0257:Alk UTSW 17 72603495 missense probably damaging 1.00
R0269:Alk UTSW 17 72603583 missense probably damaging 1.00
R0395:Alk UTSW 17 72603531 missense probably damaging 0.99
R0414:Alk UTSW 17 71899286 splice site probably benign
R0466:Alk UTSW 17 71905157 missense possibly damaging 0.51
R0526:Alk UTSW 17 71869753 missense probably damaging 1.00
R0617:Alk UTSW 17 72603583 missense probably damaging 1.00
R0781:Alk UTSW 17 71984745 splice site probably benign
R0830:Alk UTSW 17 72603200 missense probably benign 0.01
R0835:Alk UTSW 17 71869842 missense probably damaging 0.97
R0894:Alk UTSW 17 71895935 missense probably damaging 1.00
R1110:Alk UTSW 17 71984745 splice site probably benign
R1170:Alk UTSW 17 71900734 missense probably damaging 1.00
R1573:Alk UTSW 17 72603118 missense possibly damaging 0.69
R1667:Alk UTSW 17 71911567 missense probably damaging 1.00
R1748:Alk UTSW 17 72603421 missense probably benign 0.19
R1767:Alk UTSW 17 71900698 missense possibly damaging 0.73
R1836:Alk UTSW 17 71891037 missense probably damaging 1.00
R1861:Alk UTSW 17 71874938 splice site probably benign
R2905:Alk UTSW 17 71985494 missense probably benign 0.40
R2925:Alk UTSW 17 72603207 missense probably benign
R3727:Alk UTSW 17 71901400 splice site probably benign
R3747:Alk UTSW 17 71911565 missense probably damaging 0.99
R3790:Alk UTSW 17 72603432 missense possibly damaging 0.95
R3909:Alk UTSW 17 71897911 missense probably benign 0.00
R3934:Alk UTSW 17 72205954 missense probably damaging 1.00
R3936:Alk UTSW 17 72205954 missense probably damaging 1.00
R3972:Alk UTSW 17 71985447 missense probably benign 0.16
R4433:Alk UTSW 17 71899241 nonsense probably null
R4716:Alk UTSW 17 72205942 missense probably damaging 1.00
R4903:Alk UTSW 17 71869563 missense probably damaging 1.00
R4921:Alk UTSW 17 71904315 missense probably benign 0.30
R4954:Alk UTSW 17 71902692 nonsense probably null
R5377:Alk UTSW 17 71895739 missense probably damaging 1.00
R5386:Alk UTSW 17 71875012 missense probably damaging 1.00
R5551:Alk UTSW 17 71875033 missense possibly damaging 0.53
R5704:Alk UTSW 17 72603120 missense probably damaging 1.00
R5877:Alk UTSW 17 71967526 missense probably damaging 1.00
R5888:Alk UTSW 17 71874943 missense probably damaging 1.00
R6013:Alk UTSW 17 71900737 missense probably benign 0.15
R6044:Alk UTSW 17 71992100 missense probably benign 0.00
R6058:Alk UTSW 17 71869747 missense probably benign 0.01
R6126:Alk UTSW 17 71875042 missense possibly damaging 0.82
R6286:Alk UTSW 17 71880847 missense probably damaging 0.98
R6744:Alk UTSW 17 72603082 missense probably benign 0.35
R6989:Alk UTSW 17 71897952 missense probably benign 0.00
R7487:Alk UTSW 17 71949898 missense probably benign
R7573:Alk UTSW 17 71900792 missense probably damaging 1.00
R7838:Alk UTSW 17 71967554 missense possibly damaging 0.53
R8055:Alk UTSW 17 71899257 missense probably benign 0.19
R8211:Alk UTSW 17 71869707 missense probably benign
R8555:Alk UTSW 17 71921874 missense probably damaging 1.00
R8676:Alk UTSW 17 71897941 missense probably damaging 0.98
R8847:Alk UTSW 17 71949825 missense probably benign 0.14
R8885:Alk UTSW 17 71895763 missense probably damaging 1.00
RF013:Alk UTSW 17 71895936 missense probably damaging 1.00
Z1088:Alk UTSW 17 72205807 missense probably damaging 0.96
Z1177:Alk UTSW 17 72603063 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAGAGACCCACACAGCTTC -3'
(R):5'- CCCCAATTTCAGTGACTTATGG -3'

Sequencing Primer
(F):5'- TGAGAGACCCACACAGCTTCTTTAG -3'
(R):5'- CAGTGACTTATGGTCTTACCTCTAG -3'
Posted On2019-12-04