Incidental Mutation 'RF019:Otol1'
ID603726
Institutional Source Beutler Lab
Gene Symbol Otol1
Ensembl Gene ENSMUSG00000027788
Gene Nameotolin 1
SynonymsGm414, LOC229389
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF019 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location70007613-70028708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70018600 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 36 (E36V)
Ref Sequence ENSEMBL: ENSMUSP00000057607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053013]
Predicted Effect probably benign
Transcript: ENSMUST00000053013
AA Change: E36V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000057607
Gene: ENSMUSG00000027788
AA Change: E36V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Collagen 116 175 8.8e-11 PFAM
internal_repeat_2 183 229 1.02e-7 PROSPERO
Pfam:Collagen 232 302 2.4e-9 PFAM
low complexity region 328 340 N/A INTRINSIC
C1Q 341 475 9.83e-51 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 86% (36/42)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A G 1: 138,856,691 S43P probably benign Het
3110021N24Rik AGCGCGGCCGGG AG 4: 108,780,630 probably null Het
4931406P16Rik A G 7: 34,240,549 F918L probably damaging Het
Ankrd11 A G 8: 122,896,634 V294A probably damaging Het
Ciita T A 16: 10,506,747 I181N probably damaging Het
Col6a1 T C 10: 76,711,615 M675V unknown Het
Colec11 A G 12: 28,612,883 V62A probably benign Het
Eif3i T C 4: 129,600,465 T14A probably damaging Het
Filip1l A G 16: 57,570,641 T531A probably benign Het
Fscb GAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT GAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,596 probably benign Het
Gpr89 T C 3: 96,905,193 I11V probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hivep3 T C 4: 120,098,270 V1261A probably benign Het
Itgad C A 7: 128,192,208 H751N probably benign Het
Krtap28-10 CCACAGCCACAGCCA CCACAGCCACAGCCAACACAGCCACAGCCA 1: 83,042,269 probably benign Het
L1td1 A G 4: 98,736,824 K419E not run Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbtps1 A T 8: 119,525,550 W534R probably damaging Het
Myo9a T C 9: 59,921,772 V2387A probably benign Het
Ncapg C A 5: 45,698,856 P949Q probably benign Het
Nuggc T C 14: 65,648,264 F796S probably damaging Het
Pkhd1l1 TT TTTTTTTTTAT 15: 44,558,507 probably benign Het
Ralgapa2 A G 2: 146,361,503 I1095T possibly damaging Het
Reep1 C CCGCG 6: 71,707,969 probably null Het
Smarca2 GCAGCA GCAGCAACAGCA 19: 26,631,001 probably benign Het
Tcf20 T C 15: 82,851,593 I1886V probably benign Het
Txnrd1 T G 10: 82,885,100 probably null Het
Unc5b A G 10: 60,783,183 V60A probably damaging Het
Vmn1r45 A T 6: 89,933,109 V293E probably damaging Het
Zfhx4 T A 3: 5,403,267 D2853E probably benign Het
Zfp108 G T 7: 24,261,607 R541L probably benign Het
Other mutations in Otol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Otol1 APN 3 70027724 missense probably damaging 1.00
IGL01664:Otol1 APN 3 70027797 missense probably benign 0.01
IGL02205:Otol1 APN 3 70018596 missense probably benign
IGL02445:Otol1 APN 3 70028034 missense probably damaging 1.00
IGL02674:Otol1 APN 3 70018744 missense probably benign 0.01
IGL03376:Otol1 APN 3 70027512 missense probably damaging 0.96
R0094:Otol1 UTSW 3 70018683 missense probably benign 0.03
R0492:Otol1 UTSW 3 70027784 missense probably damaging 0.99
R0504:Otol1 UTSW 3 70027604 missense probably damaging 1.00
R1932:Otol1 UTSW 3 70028104 missense probably benign 0.01
R2049:Otol1 UTSW 3 70018836 missense probably benign 0.06
R2321:Otol1 UTSW 3 70018525 nonsense probably null
R4042:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4043:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4044:Otol1 UTSW 3 70027779 missense probably damaging 1.00
R4092:Otol1 UTSW 3 70027785 missense probably damaging 0.99
R4433:Otol1 UTSW 3 70018548 missense probably benign 0.02
R4993:Otol1 UTSW 3 70018878 missense probably benign 0.07
R6921:Otol1 UTSW 3 70028100 missense possibly damaging 0.89
R6983:Otol1 UTSW 3 70028041 missense probably damaging 1.00
R7095:Otol1 UTSW 3 70018694 missense probably benign 0.00
R7619:Otol1 UTSW 3 70027869 missense probably damaging 1.00
X0062:Otol1 UTSW 3 70027640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCCAGAGATGCATTTATTC -3'
(R):5'- GTTGTGTCCAGAGAGAAGCTC -3'

Sequencing Primer
(F):5'- TTCTTCCCATACAAGGATAGATGG -3'
(R):5'- GCTCTCGAAGGGAAGGAGAC -3'
Posted On2019-12-04