Incidental Mutation 'RF019:Reep1'
ID603734
Institutional Source Beutler Lab
Gene Symbol Reep1
Ensembl Gene ENSMUSG00000052852
Gene Namereceptor accessory protein 1
SynonymsD6Ertd253e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF019 (G1)
Quality Score198.468
Status Not validated
Chromosome6
Chromosomal Location71707561-71810710 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to CCGCG at 71707969 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121469] [ENSMUST00000212631] [ENSMUST00000212792]
Predicted Effect probably null
Transcript: ENSMUST00000121469
SMART Domains Protein: ENSMUSP00000112662
Gene: ENSMUSG00000052852

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.1e-35 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212631
Predicted Effect probably null
Transcript: ENSMUST00000212792
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.8%
Validation Efficiency 86% (36/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spastic paraplegia in aged mice with reduced ER complexity in cortical motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A G 1: 138,856,691 S43P probably benign Het
3110021N24Rik AGCGCGGCCGGG AG 4: 108,780,630 probably null Het
4931406P16Rik A G 7: 34,240,549 F918L probably damaging Het
Ankrd11 A G 8: 122,896,634 V294A probably damaging Het
Ciita T A 16: 10,506,747 I181N probably damaging Het
Col6a1 T C 10: 76,711,615 M675V unknown Het
Colec11 A G 12: 28,612,883 V62A probably benign Het
Eif3i T C 4: 129,600,465 T14A probably damaging Het
Filip1l A G 16: 57,570,641 T531A probably benign Het
Fscb GAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT GAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGTAGAACTTCTACAGGGGCCTCCTCAGTTGCTGGAGGT 12: 64,472,596 probably benign Het
Gpr89 T C 3: 96,905,193 I11V probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hivep3 T C 4: 120,098,270 V1261A probably benign Het
Itgad C A 7: 128,192,208 H751N probably benign Het
Krtap28-10 CCACAGCCACAGCCA CCACAGCCACAGCCAACACAGCCACAGCCA 1: 83,042,269 probably benign Het
L1td1 A G 4: 98,736,824 K419E not run Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbtps1 A T 8: 119,525,550 W534R probably damaging Het
Myo9a T C 9: 59,921,772 V2387A probably benign Het
Ncapg C A 5: 45,698,856 P949Q probably benign Het
Nuggc T C 14: 65,648,264 F796S probably damaging Het
Otol1 A T 3: 70,018,600 E36V probably benign Het
Pkhd1l1 TT TTTTTTTTTAT 15: 44,558,507 probably benign Het
Ralgapa2 A G 2: 146,361,503 I1095T possibly damaging Het
Smarca2 GCAGCA GCAGCAACAGCA 19: 26,631,001 probably benign Het
Tcf20 T C 15: 82,851,593 I1886V probably benign Het
Txnrd1 T G 10: 82,885,100 probably null Het
Unc5b A G 10: 60,783,183 V60A probably damaging Het
Vmn1r45 A T 6: 89,933,109 V293E probably damaging Het
Zfhx4 T A 3: 5,403,267 D2853E probably benign Het
Zfp108 G T 7: 24,261,607 R541L probably benign Het
Other mutations in Reep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Reep1 APN 6 71773288 missense probably damaging 1.00
IGL03057:Reep1 APN 6 71807781 splice site probably benign
R1596:Reep1 UTSW 6 71756437 critical splice donor site probably null
R1899:Reep1 UTSW 6 71780797 missense probably benign 0.32
R2201:Reep1 UTSW 6 71773294 missense probably damaging 1.00
R2252:Reep1 UTSW 6 71756442 splice site probably null
R3787:Reep1 UTSW 6 71795215 missense probably damaging 0.98
R4760:Reep1 UTSW 6 71708001 missense possibly damaging 0.67
R5657:Reep1 UTSW 6 71761374 missense possibly damaging 0.89
R6619:Reep1 UTSW 6 71807842 utr 3 prime probably benign
R6659:Reep1 UTSW 6 71773195 missense probably damaging 1.00
R7080:Reep1 UTSW 6 71780765 missense possibly damaging 0.81
R7299:Reep1 UTSW 6 71761389 missense probably benign 0.02
R7730:Reep1 UTSW 6 71780741 missense possibly damaging 0.64
RF023:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF029:Reep1 UTSW 6 71707966 start codon destroyed probably null
RF032:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF042:Reep1 UTSW 6 71707966 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CACCACACGGTTTCACAAGGAG -3'
(R):5'- GCTAAATTTAGCGACCGCC -3'

Sequencing Primer
(F):5'- CTGGGACGATCGGAGCAG -3'
(R):5'- CCGGGTATTAATAGCTAGCGACC -3'
Posted On2019-12-04