Incidental Mutation 'RF020:Dnah7b'
ID 603763
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Name dynein, axonemal, heavy chain 7B
Synonyms LOC227058, Dnahc7b
Accession Numbers
Essential gene? Probably non essential (E-score: 0.165) question?
Stock # RF020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 46105475-46412710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46412421 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 4010 (D4010G)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069293
AA Change: D4010G

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: D4010G

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185879
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,132,880 (GRCm39) K1270E possibly damaging Het
Adgrb2 T C 4: 129,903,877 (GRCm39) S668P probably damaging Het
Ahdc1 T G 4: 132,791,588 (GRCm39) L943R possibly damaging Het
Ank2 T C 3: 126,739,125 (GRCm39) K2253R unknown Het
Arhgap23 T C 11: 97,354,387 (GRCm39) S767P probably damaging Het
Arhgef12 A G 9: 42,901,285 (GRCm39) I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 108,999,350 (GRCm39) probably benign Het
Btbd19 A T 4: 116,979,472 (GRCm39) C116S probably damaging Het
Cbr1 C T 16: 93,407,067 (GRCm39) A261V probably benign Het
Ccdc137 A G 11: 120,349,022 (GRCm39) R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,865,876 (GRCm39) probably benign Het
Celsr3 C T 9: 108,726,256 (GRCm39) R3162C probably benign Het
Cep350 A T 1: 155,791,224 (GRCm39) V1300E probably benign Het
Cluh G GCCAGAT 11: 74,560,364 (GRCm39) probably benign Het
Cmya5 G T 13: 93,205,799 (GRCm39) Q3357K possibly damaging Het
Col6a2 T G 10: 76,442,043 (GRCm39) probably null Het
Cyp2j9 T A 4: 96,465,889 (GRCm39) T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,892,525 (GRCm39) probably null Het
Dnah6 T A 6: 73,095,040 (GRCm39) Y2181F probably benign Het
E4f1 CCG CCGACG 17: 24,674,169 (GRCm39) probably benign Het
Ep300 A T 15: 81,470,772 (GRCm39) probably benign Het
Fam234a A G 17: 26,437,725 (GRCm39) V90A probably benign Het
Gab3 TCT TCTGCT X: 74,043,623 (GRCm39) probably benign Het
Gal3st1 A G 11: 3,948,153 (GRCm39) Y120C possibly damaging Het
Garin5a GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,149,959 (GRCm39) probably null Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,325,030 (GRCm39) probably null Het
Gm6665 T TC 18: 31,953,430 (GRCm39) probably null Het
Hdlbp T C 1: 93,368,456 (GRCm39) T8A probably benign Het
Hnrnpa2b1 T A 6: 51,443,674 (GRCm39) K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 (GRCm39) probably benign Het
Klhl10 C G 11: 100,332,896 (GRCm39) Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,198,801 (GRCm39) probably null Het
Kmt2b CC CCTCCTGC 7: 30,285,807 (GRCm39) probably benign Het
Krt1c A G 15: 101,726,403 (GRCm39) I45T unknown Het
Ksr2 T C 5: 117,693,283 (GRCm39) S244P probably benign Het
Lama5 A T 2: 179,837,971 (GRCm39) M915K probably benign Het
Lrp1b A C 2: 41,660,858 (GRCm39) H197Q Het
Lrrc1 T C 9: 77,359,913 (GRCm39) E293G probably damaging Het
Med12l AACA AACAACA 3: 59,183,379 (GRCm39) probably benign Het
Mgam T A 6: 40,662,243 (GRCm39) Y1179N probably damaging Het
Mgat4c A G 10: 102,224,928 (GRCm39) I381V probably benign Het
Mrgprx1 A AGAC 7: 47,671,259 (GRCm39) probably benign Het
Myc A T 15: 61,857,672 (GRCm39) probably benign Het
Nipbl A G 15: 8,388,418 (GRCm39) S401P probably damaging Het
Nlrp9c A T 7: 26,084,649 (GRCm39) I310N probably benign Het
Nwd2 C A 5: 63,963,066 (GRCm39) Y883* probably null Het
Oas1e T A 5: 120,932,383 (GRCm39) T87S possibly damaging Het
Or10n7-ps1 GA GATACA 9: 39,598,049 (GRCm39) probably null Het
Or51a5 A T 7: 102,771,098 (GRCm39) C294S probably benign Het
Or52d3 A G 7: 104,229,497 (GRCm39) M215V probably benign Het
Or8b38 G A 9: 37,972,620 (GRCm39) M1I probably null Het
Pappa T G 4: 65,123,282 (GRCm39) S872R possibly damaging Het
Parp4 T C 14: 56,884,806 (GRCm39) L1295P unknown Het
Pcdh15 A T 10: 74,021,242 (GRCm39) Y152F probably damaging Het
Pdk1 A T 2: 71,714,240 (GRCm39) I217L possibly damaging Het
Phldb1 A C 9: 44,609,243 (GRCm39) C450W probably damaging Het
Pnma8a C CCATGATGCACCTGCTTCAACATCA 7: 16,695,376 (GRCm39) probably benign Het
Prl2c5 G A 13: 13,360,497 (GRCm39) G55S probably benign Het
Psme2b A T 11: 48,836,397 (GRCm39) H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,891,412 (GRCm39) probably benign Het
Rln3 T C 8: 84,769,931 (GRCm39) T73A probably benign Het
Rprd1a T A 18: 24,663,062 (GRCm39) Q21L probably damaging Het
Septin3 A T 15: 82,168,662 (GRCm39) D155V probably damaging Het
Sh3rf3 T A 10: 58,649,590 (GRCm39) V65E probably damaging Het
Shank3 A G 15: 89,384,593 (GRCm39) N155S probably benign Het
Shox2 G T 3: 66,881,146 (GRCm39) P278Q probably damaging Het
Slc1a1 T C 19: 28,856,555 (GRCm39) probably null Het
Slc39a10 A T 1: 46,849,175 (GRCm39) F814I probably damaging Het
Slc5a1 T C 5: 33,290,773 (GRCm39) I119T probably damaging Het
Slc6a13 T C 6: 121,301,310 (GRCm39) probably null Het
Spmap2l CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,164,247 (GRCm39) probably benign Het
Spta1 A G 1: 174,041,010 (GRCm39) D1270G probably benign Het
Spta1 T A 1: 174,045,469 (GRCm39) F1542L probably damaging Het
Tacc3 T A 5: 33,818,568 (GRCm39) M1K probably null Het
Tax1bp1 T C 6: 52,698,339 (GRCm39) V17A probably damaging Het
Tmem156 T A 5: 65,248,890 (GRCm39) E3D probably benign Het
Tmem209 T A 6: 30,487,417 (GRCm39) M530L probably benign Het
Trpc2 A G 7: 101,745,433 (GRCm39) D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,698,795 (GRCm39) probably null Het
Uhrf2 T C 19: 30,063,791 (GRCm39) Y585H probably damaging Het
Vmn1r26 T A 6: 57,985,705 (GRCm39) K161N probably benign Het
Vmn1r29 A G 6: 58,284,528 (GRCm39) S83G probably benign Het
Vps13b G T 15: 35,925,552 (GRCm39) W3829L probably null Het
Vwce G A 19: 10,630,449 (GRCm39) G503R probably damaging Het
Zc3h11a T C 1: 133,554,735 (GRCm39) E415G possibly damaging Het
Zc3h14 T A 12: 98,746,541 (GRCm39) probably null Het
Zfp119b A T 17: 56,246,499 (GRCm39) M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,013,418 (GRCm39) probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,013,451 (GRCm39) probably benign Het
Zyx T A 6: 42,334,330 (GRCm39) L518Q probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46,181,309 (GRCm39) missense probably benign 0.04
IGL00796:Dnah7b APN 1 46,250,497 (GRCm39) missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46,263,811 (GRCm39) missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46,105,889 (GRCm39) unclassified probably benign
IGL00950:Dnah7b APN 1 46,253,482 (GRCm39) missense probably benign 0.07
IGL01142:Dnah7b APN 1 46,234,538 (GRCm39) critical splice donor site probably null
IGL01350:Dnah7b APN 1 46,120,592 (GRCm39) splice site probably benign
IGL01392:Dnah7b APN 1 46,165,948 (GRCm39) missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46,155,460 (GRCm39) splice site probably benign
IGL01460:Dnah7b APN 1 46,178,864 (GRCm39) missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46,307,813 (GRCm39) missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46,397,307 (GRCm39) missense probably benign 0.29
IGL01838:Dnah7b APN 1 46,397,297 (GRCm39) nonsense probably null
IGL01906:Dnah7b APN 1 46,214,613 (GRCm39) missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46,163,497 (GRCm39) splice site probably benign
IGL01989:Dnah7b APN 1 46,328,694 (GRCm39) missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46,179,035 (GRCm39) missense probably benign
IGL02213:Dnah7b APN 1 46,272,752 (GRCm39) missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46,266,090 (GRCm39) missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46,138,663 (GRCm39) nonsense probably null
IGL02381:Dnah7b APN 1 46,316,280 (GRCm39) missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46,273,353 (GRCm39) missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46,234,478 (GRCm39) missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46,162,937 (GRCm39) missense probably benign 0.02
IGL02655:Dnah7b APN 1 46,155,461 (GRCm39) splice site probably benign
IGL02704:Dnah7b APN 1 46,181,293 (GRCm39) missense probably benign 0.03
IGL02719:Dnah7b APN 1 46,138,768 (GRCm39) splice site probably benign
IGL02745:Dnah7b APN 1 46,234,189 (GRCm39) splice site probably benign
IGL02818:Dnah7b APN 1 46,329,968 (GRCm39) missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46,158,458 (GRCm39) missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46,221,535 (GRCm39) missense probably benign 0.00
IGL03354:Dnah7b APN 1 46,124,849 (GRCm39) missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46,158,464 (GRCm39) missense probably benign 0.18
BB001:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
BB011:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46,412,508 (GRCm39) missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46,252,520 (GRCm39) missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46,262,338 (GRCm39) missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46,258,508 (GRCm39) missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46,162,937 (GRCm39) missense probably benign 0.26
R0313:Dnah7b UTSW 1 46,246,803 (GRCm39) missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46,173,816 (GRCm39) missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46,280,104 (GRCm39) missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46,316,286 (GRCm39) missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46,275,948 (GRCm39) missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46,179,336 (GRCm39) missense probably benign 0.00
R0502:Dnah7b UTSW 1 46,258,704 (GRCm39) missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46,280,152 (GRCm39) missense probably benign 0.02
R0664:Dnah7b UTSW 1 46,364,002 (GRCm39) missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46,379,292 (GRCm39) missense probably benign 0.00
R0931:Dnah7b UTSW 1 46,138,772 (GRCm39) splice site probably benign
R1035:Dnah7b UTSW 1 46,163,608 (GRCm39) missense probably benign
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46,379,426 (GRCm39) missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46,364,970 (GRCm39) missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46,379,280 (GRCm39) missense probably benign 0.00
R1318:Dnah7b UTSW 1 46,138,669 (GRCm39) missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46,328,816 (GRCm39) missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46,117,753 (GRCm39) splice site probably benign
R1484:Dnah7b UTSW 1 46,176,703 (GRCm39) missense probably benign 0.00
R1529:Dnah7b UTSW 1 46,216,441 (GRCm39) missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46,105,957 (GRCm39) missense unknown
R1607:Dnah7b UTSW 1 46,329,806 (GRCm39) missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46,392,126 (GRCm39) missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46,214,550 (GRCm39) nonsense probably null
R1681:Dnah7b UTSW 1 46,363,872 (GRCm39) nonsense probably null
R1716:Dnah7b UTSW 1 46,230,943 (GRCm39) missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46,361,495 (GRCm39) missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46,272,919 (GRCm39) missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46,316,265 (GRCm39) missense probably damaging 1.00
R1838:Dnah7b UTSW 1 46,155,337 (GRCm39) missense probably benign 0.04
R1898:Dnah7b UTSW 1 46,275,874 (GRCm39) missense probably benign 0.02
R1962:Dnah7b UTSW 1 46,281,263 (GRCm39) missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46,181,247 (GRCm39) missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46,281,481 (GRCm39) nonsense probably null
R2083:Dnah7b UTSW 1 46,280,227 (GRCm39) missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46,307,830 (GRCm39) missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46,137,152 (GRCm39) splice site probably benign
R2172:Dnah7b UTSW 1 46,163,672 (GRCm39) missense probably benign 0.12
R2239:Dnah7b UTSW 1 46,240,344 (GRCm39) splice site probably benign
R2247:Dnah7b UTSW 1 46,316,223 (GRCm39) missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46,273,075 (GRCm39) missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46,402,114 (GRCm39) missense probably benign 0.31
R2509:Dnah7b UTSW 1 46,234,447 (GRCm39) missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46,178,901 (GRCm39) missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46,246,732 (GRCm39) missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46,227,847 (GRCm39) critical splice donor site probably null
R3022:Dnah7b UTSW 1 46,221,583 (GRCm39) missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46,307,869 (GRCm39) missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46,392,033 (GRCm39) missense probably benign 0.00
R3735:Dnah7b UTSW 1 46,339,035 (GRCm39) missense probably benign 0.05
R3898:Dnah7b UTSW 1 46,282,417 (GRCm39) missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46,176,645 (GRCm39) missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46,272,871 (GRCm39) missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46,120,655 (GRCm39) missense probably benign
R4172:Dnah7b UTSW 1 46,266,106 (GRCm39) missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46,176,578 (GRCm39) missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46,260,932 (GRCm39) missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
R4414:Dnah7b UTSW 1 46,165,840 (GRCm39) missense probably benign 0.00
R4495:Dnah7b UTSW 1 46,124,792 (GRCm39) missense probably benign 0.00
R4660:Dnah7b UTSW 1 46,328,696 (GRCm39) missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46,117,684 (GRCm39) missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46,256,317 (GRCm39) missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46,250,488 (GRCm39) missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46,246,816 (GRCm39) missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46,106,115 (GRCm39) missense unknown
R4780:Dnah7b UTSW 1 46,392,174 (GRCm39) missense probably benign
R4828:Dnah7b UTSW 1 46,167,272 (GRCm39) missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46,395,762 (GRCm39) missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46,234,234 (GRCm39) missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46,120,604 (GRCm39) missense probably benign 0.21
R4881:Dnah7b UTSW 1 46,240,478 (GRCm39) missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46,329,935 (GRCm39) missense probably benign 0.04
R4960:Dnah7b UTSW 1 46,272,886 (GRCm39) missense probably benign
R5000:Dnah7b UTSW 1 46,138,663 (GRCm39) nonsense probably null
R5005:Dnah7b UTSW 1 46,281,188 (GRCm39) missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46,226,523 (GRCm39) missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46,221,540 (GRCm39) nonsense probably null
R5174:Dnah7b UTSW 1 46,282,509 (GRCm39) missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46,397,376 (GRCm39) missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46,273,018 (GRCm39) missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46,412,514 (GRCm39) missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46,272,849 (GRCm39) missense probably benign 0.16
R5380:Dnah7b UTSW 1 46,256,351 (GRCm39) missense probably benign 0.18
R5387:Dnah7b UTSW 1 46,227,819 (GRCm39) missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46,397,431 (GRCm39) missense probably benign 0.01
R5426:Dnah7b UTSW 1 46,281,366 (GRCm39) missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46,281,179 (GRCm39) missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46,148,472 (GRCm39) missense probably null
R5479:Dnah7b UTSW 1 46,262,265 (GRCm39) missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46,281,359 (GRCm39) missense probably benign 0.06
R5637:Dnah7b UTSW 1 46,395,674 (GRCm39) missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46,307,924 (GRCm39) splice site probably null
R5659:Dnah7b UTSW 1 46,392,009 (GRCm39) missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46,273,152 (GRCm39) missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46,316,280 (GRCm39) missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46,181,292 (GRCm39) missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46,230,885 (GRCm39) missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46,376,753 (GRCm39) critical splice donor site probably null
R5918:Dnah7b UTSW 1 46,260,803 (GRCm39) missense probably benign
R5941:Dnah7b UTSW 1 46,226,450 (GRCm39) missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46,402,147 (GRCm39) missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46,158,558 (GRCm39) splice site probably null
R6041:Dnah7b UTSW 1 46,328,805 (GRCm39) missense probably benign 0.04
R6043:Dnah7b UTSW 1 46,178,949 (GRCm39) missense probably benign
R6049:Dnah7b UTSW 1 46,124,762 (GRCm39) missense probably benign
R6131:Dnah7b UTSW 1 46,292,626 (GRCm39) missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46,329,863 (GRCm39) missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46,272,745 (GRCm39) missense probably benign 0.03
R6226:Dnah7b UTSW 1 46,165,828 (GRCm39) missense probably benign 0.01
R6233:Dnah7b UTSW 1 46,243,429 (GRCm39) missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46,265,048 (GRCm39) missense probably benign
R6273:Dnah7b UTSW 1 46,281,476 (GRCm39) missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46,365,046 (GRCm39) missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46,379,335 (GRCm39) missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46,281,364 (GRCm39) nonsense probably null
R6494:Dnah7b UTSW 1 46,138,591 (GRCm39) missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46,263,902 (GRCm39) missense probably benign 0.12
R6800:Dnah7b UTSW 1 46,379,377 (GRCm39) missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46,230,948 (GRCm39) missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46,234,280 (GRCm39) missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46,158,428 (GRCm39) missense probably benign 0.12
R6969:Dnah7b UTSW 1 46,397,398 (GRCm39) missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46,234,299 (GRCm39) critical splice donor site probably null
R7040:Dnah7b UTSW 1 46,275,969 (GRCm39) missense probably benign 0.01
R7117:Dnah7b UTSW 1 46,391,973 (GRCm39) critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46,178,870 (GRCm39) missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.05
R7189:Dnah7b UTSW 1 46,281,302 (GRCm39) missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46,179,126 (GRCm39) missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46,122,914 (GRCm39) missense probably benign
R7244:Dnah7b UTSW 1 46,316,303 (GRCm39) missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46,181,245 (GRCm39) missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46,234,532 (GRCm39) missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46,342,794 (GRCm39) missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46,214,579 (GRCm39) missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46,329,894 (GRCm39) missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46,364,925 (GRCm39) missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46,395,714 (GRCm39) missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46,163,506 (GRCm39) missense probably benign 0.06
R7547:Dnah7b UTSW 1 46,253,573 (GRCm39) missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46,307,794 (GRCm39) missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46,148,462 (GRCm39) missense probably benign
R7676:Dnah7b UTSW 1 46,273,324 (GRCm39) nonsense probably null
R7731:Dnah7b UTSW 1 46,178,905 (GRCm39) missense probably benign 0.00
R7760:Dnah7b UTSW 1 46,240,413 (GRCm39) missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46,176,634 (GRCm39) missense probably benign
R7807:Dnah7b UTSW 1 46,253,527 (GRCm39) missense probably benign
R7895:Dnah7b UTSW 1 46,289,110 (GRCm39) missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46,178,838 (GRCm39) missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46,258,590 (GRCm39) missense probably benign 0.04
R7944:Dnah7b UTSW 1 46,266,163 (GRCm39) missense probably benign
R7946:Dnah7b UTSW 1 46,272,739 (GRCm39) missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46,282,584 (GRCm39) missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46,282,525 (GRCm39) missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46,263,866 (GRCm39) nonsense probably null
R8094:Dnah7b UTSW 1 46,165,964 (GRCm39) missense probably benign 0.01
R8137:Dnah7b UTSW 1 46,272,913 (GRCm39) missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46,292,671 (GRCm39) missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46,395,736 (GRCm39) missense probably benign 0.43
R8309:Dnah7b UTSW 1 46,179,032 (GRCm39) missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46,214,456 (GRCm39) missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46,395,819 (GRCm39) critical splice donor site probably null
R8438:Dnah7b UTSW 1 46,227,839 (GRCm39) missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46,329,875 (GRCm39) missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46,138,650 (GRCm39) missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46,155,360 (GRCm39) missense possibly damaging 0.94
R8711:Dnah7b UTSW 1 46,214,598 (GRCm39) missense probably damaging 1.00
R8745:Dnah7b UTSW 1 46,221,624 (GRCm39) missense possibly damaging 0.82
R8765:Dnah7b UTSW 1 46,392,159 (GRCm39) missense possibly damaging 0.91
R8797:Dnah7b UTSW 1 46,162,806 (GRCm39) missense probably damaging 1.00
R8805:Dnah7b UTSW 1 46,273,305 (GRCm39) missense possibly damaging 0.90
R8830:Dnah7b UTSW 1 46,230,953 (GRCm39) missense probably damaging 1.00
R8861:Dnah7b UTSW 1 46,280,236 (GRCm39) missense possibly damaging 0.82
R8905:Dnah7b UTSW 1 46,292,534 (GRCm39) missense probably damaging 0.99
R9009:Dnah7b UTSW 1 46,262,232 (GRCm39) missense probably benign 0.00
R9058:Dnah7b UTSW 1 46,282,575 (GRCm39) missense probably damaging 1.00
R9130:Dnah7b UTSW 1 46,173,674 (GRCm39) missense probably benign 0.01
R9131:Dnah7b UTSW 1 46,266,180 (GRCm39) missense probably damaging 1.00
R9181:Dnah7b UTSW 1 46,181,194 (GRCm39) missense probably damaging 1.00
R9182:Dnah7b UTSW 1 46,330,038 (GRCm39) missense probably benign 0.06
R9223:Dnah7b UTSW 1 46,361,420 (GRCm39) missense probably benign 0.12
R9391:Dnah7b UTSW 1 46,272,914 (GRCm39) nonsense probably null
R9392:Dnah7b UTSW 1 46,162,898 (GRCm39) nonsense probably null
R9456:Dnah7b UTSW 1 46,165,953 (GRCm39) missense possibly damaging 0.82
R9498:Dnah7b UTSW 1 46,253,564 (GRCm39) missense probably benign 0.27
R9553:Dnah7b UTSW 1 46,264,956 (GRCm39) missense probably damaging 0.99
R9598:Dnah7b UTSW 1 46,292,621 (GRCm39) missense possibly damaging 0.67
R9653:Dnah7b UTSW 1 46,252,544 (GRCm39) missense possibly damaging 0.55
R9781:Dnah7b UTSW 1 46,376,754 (GRCm39) splice site probably null
V8831:Dnah7b UTSW 1 46,412,458 (GRCm39) nonsense probably null
X0023:Dnah7b UTSW 1 46,342,737 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGAGGCAAACTGTTTTCTCTTTG -3'
(R):5'- AGTTGCAAGAGATGATGCCAC -3'

Sequencing Primer
(F):5'- GGCAAACTGTTTTCTCTTTGTATAC -3'
(R):5'- TTGCAAGAGATGATGCCACATTCAG -3'
Posted On 2019-12-04