Incidental Mutation 'RF020:Spta1'
ID603768
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #RF020 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174213444 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1270 (D1270G)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably benign
Transcript: ENSMUST00000027817
AA Change: D1270G

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: D1270G

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,533,657 K1270E possibly damaging Het
Adgrb2 T C 4: 130,010,084 S668P probably damaging Het
Ahdc1 T G 4: 133,064,277 L943R possibly damaging Het
Ank2 T C 3: 126,945,476 K2253R unknown Het
Arhgap23 T C 11: 97,463,561 S767P probably damaging Het
Arhgef12 A G 9: 42,989,989 I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Btbd19 A T 4: 117,122,275 C116S probably damaging Het
Cbr1 C T 16: 93,610,179 A261V probably benign Het
Ccdc137 A G 11: 120,458,196 R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Celsr3 C T 9: 108,849,057 R3162C probably benign Het
Cep350 A T 1: 155,915,478 V1300E probably benign Het
Cluh G GCCAGAT 11: 74,669,538 probably benign Het
Cmya5 G T 13: 93,069,291 Q3357K possibly damaging Het
Col6a2 T G 10: 76,606,209 probably null Het
Cyp2j9 T A 4: 96,577,652 T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dnah6 T A 6: 73,118,057 Y2181F probably benign Het
Dnah7b A G 1: 46,373,261 D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,455,195 probably benign Het
Ep300 A T 15: 81,586,571 probably benign Het
Fam234a A G 17: 26,218,751 V90A probably benign Het
Fam71e1 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,500,535 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gal3st1 A G 11: 3,998,153 Y120C possibly damaging Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,427,149 probably null Het
Gm6665 T TC 18: 31,820,377 probably null Het
Hdlbp T C 1: 93,440,734 T8A probably benign Het
Hnrnpa2b1 T A 6: 51,466,694 K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Klhl10 C G 11: 100,442,070 Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2b CC CCTCCTGC 7: 30,586,382 probably benign Het
Krt2 A G 15: 101,817,968 I45T unknown Het
Ksr2 T C 5: 117,555,218 S244P probably benign Het
Lama5 A T 2: 180,196,178 M915K probably benign Het
Lrp1b A C 2: 41,770,846 H197Q Het
Lrrc1 T C 9: 77,452,631 E293G probably damaging Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Mgam T A 6: 40,685,309 Y1179N probably damaging Het
Mgat4c A G 10: 102,389,067 I381V probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Myc A T 15: 61,985,823 probably benign Het
Nipbl A G 15: 8,358,934 S401P probably damaging Het
Nlrp9c A T 7: 26,385,224 I310N probably benign Het
Nwd2 C A 5: 63,805,723 Y883* probably null Het
Oas1e T A 5: 120,794,318 T87S possibly damaging Het
Olfr586 A T 7: 103,121,891 C294S probably benign Het
Olfr653 A G 7: 104,580,290 M215V probably benign Het
Olfr885 G A 9: 38,061,324 M1I probably null Het
Olfr964-ps1 GA GATACA 9: 39,686,753 probably null Het
Pappa T G 4: 65,205,045 S872R possibly damaging Het
Parp4 T C 14: 56,647,349 L1295P unknown Het
Pcdh15 A T 10: 74,185,410 Y152F probably damaging Het
Pdk1 A T 2: 71,883,896 I217L possibly damaging Het
Phldb1 A C 9: 44,697,946 C450W probably damaging Het
Pnmal1 C CCATGATGCACCTGCTTCAACATCA 7: 16,961,451 probably benign Het
Prl2c5 G A 13: 13,185,912 G55S probably benign Het
Psme2b A T 11: 48,945,570 H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,914,449 probably benign Het
Rln3 T C 8: 84,043,302 T73A probably benign Het
Rprd1a T A 18: 24,530,005 Q21L probably damaging Het
Sept3 A T 15: 82,284,461 D155V probably damaging Het
Sh3rf3 T A 10: 58,813,768 V65E probably damaging Het
Shank3 A G 15: 89,500,390 N155S probably benign Het
Shox2 G T 3: 66,973,813 P278Q probably damaging Het
Slc1a1 T C 19: 28,879,155 probably null Het
Slc39a10 A T 1: 46,810,015 F814I probably damaging Het
Slc5a1 T C 5: 33,133,429 I119T probably damaging Het
Slc6a13 T C 6: 121,324,351 probably null Het
Tacc3 T A 5: 33,661,224 M1K probably null Het
Tax1bp1 T C 6: 52,721,354 V17A probably damaging Het
Thegl CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,016,400 probably benign Het
Tmem156 T A 5: 65,091,547 E3D probably benign Het
Tmem209 T A 6: 30,487,418 M530L probably benign Het
Trpc2 A G 7: 102,096,226 D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,695,796 probably null Het
Uhrf2 T C 19: 30,086,391 Y585H probably damaging Het
Vmn1r26 T A 6: 58,008,720 K161N probably benign Het
Vmn1r29 A G 6: 58,307,543 S83G probably benign Het
Vps13b G T 15: 35,925,406 W3829L probably null Het
Vwce G A 19: 10,653,085 G503R probably damaging Het
Zc3h11a T C 1: 133,626,997 E415G possibly damaging Het
Zc3h14 T A 12: 98,780,282 probably null Het
Zfp119b A T 17: 55,939,499 M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,036,455 probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,036,488 probably benign Het
Zyx T A 6: 42,357,396 L518Q probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7372:Spta1 UTSW 1 174197635 nonsense probably null
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
R7770:Spta1 UTSW 1 174195981 nonsense probably null
R7784:Spta1 UTSW 1 174202451 missense probably damaging 1.00
R7804:Spta1 UTSW 1 174195905 missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7862:Spta1 UTSW 1 174197785 critical splice donor site probably null
R7937:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7945:Spta1 UTSW 1 174197785 critical splice donor site probably null
R8015:Spta1 UTSW 1 174240171 missense probably damaging 1.00
RF002:Spta1 UTSW 1 174231360 missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174209319 missense probably damaging 1.00
RF020:Spta1 UTSW 1 174217903 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174191051 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174240367 missense probably damaging 0.99
Z1177:Spta1 UTSW 1 174190162 missense probably benign 0.09
Z1177:Spta1 UTSW 1 174245689 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGGGGTTTCCAGACTGATG -3'
(R):5'- GTAGTAAATACCATTTGACCCAGG -3'

Sequencing Primer
(F):5'- CCAGACTGATGTATTGCTGAGCAG -3'
(R):5'- GACCCAGGATATTTCTAGTGGC -3'
Posted On2019-12-04