Incidental Mutation 'RF020:Pdk1'
ID603771
Institutional Source Beutler Lab
Gene Symbol Pdk1
Ensembl Gene ENSMUSG00000006494
Gene Namepyruvate dehydrogenase kinase, isoenzyme 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF020 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location71873224-71903858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71883896 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 217 (I217L)
Ref Sequence ENSEMBL: ENSMUSP00000006669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006669
AA Change: I217L

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006669
Gene: ENSMUSG00000006494
AA Change: I217L

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Pfam:BCDHK_Adom3 56 218 6.4e-52 PFAM
HATPase_c 266 391 1.82e-16 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,533,657 K1270E possibly damaging Het
Adgrb2 T C 4: 130,010,084 S668P probably damaging Het
Ahdc1 T G 4: 133,064,277 L943R possibly damaging Het
Ank2 T C 3: 126,945,476 K2253R unknown Het
Arhgap23 T C 11: 97,463,561 S767P probably damaging Het
Arhgef12 A G 9: 42,989,989 I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Btbd19 A T 4: 117,122,275 C116S probably damaging Het
Cbr1 C T 16: 93,610,179 A261V probably benign Het
Ccdc137 A G 11: 120,458,196 R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Celsr3 C T 9: 108,849,057 R3162C probably benign Het
Cep350 A T 1: 155,915,478 V1300E probably benign Het
Cluh G GCCAGAT 11: 74,669,538 probably benign Het
Cmya5 G T 13: 93,069,291 Q3357K possibly damaging Het
Col6a2 T G 10: 76,606,209 probably null Het
Cyp2j9 T A 4: 96,577,652 T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dnah6 T A 6: 73,118,057 Y2181F probably benign Het
Dnah7b A G 1: 46,373,261 D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,455,195 probably benign Het
Ep300 A T 15: 81,586,571 probably benign Het
Fam234a A G 17: 26,218,751 V90A probably benign Het
Fam71e1 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,500,535 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gal3st1 A G 11: 3,998,153 Y120C possibly damaging Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,427,149 probably null Het
Gm6665 T TC 18: 31,820,377 probably null Het
Hdlbp T C 1: 93,440,734 T8A probably benign Het
Hnrnpa2b1 T A 6: 51,466,694 K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Klhl10 C G 11: 100,442,070 Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2b CC CCTCCTGC 7: 30,586,382 probably benign Het
Krt2 A G 15: 101,817,968 I45T unknown Het
Ksr2 T C 5: 117,555,218 S244P probably benign Het
Lama5 A T 2: 180,196,178 M915K probably benign Het
Lrp1b A C 2: 41,770,846 H197Q Het
Lrrc1 T C 9: 77,452,631 E293G probably damaging Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Mgam T A 6: 40,685,309 Y1179N probably damaging Het
Mgat4c A G 10: 102,389,067 I381V probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Myc A T 15: 61,985,823 probably benign Het
Nipbl A G 15: 8,358,934 S401P probably damaging Het
Nlrp9c A T 7: 26,385,224 I310N probably benign Het
Nwd2 C A 5: 63,805,723 Y883* probably null Het
Oas1e T A 5: 120,794,318 T87S possibly damaging Het
Olfr586 A T 7: 103,121,891 C294S probably benign Het
Olfr653 A G 7: 104,580,290 M215V probably benign Het
Olfr885 G A 9: 38,061,324 M1I probably null Het
Olfr964-ps1 GA GATACA 9: 39,686,753 probably null Het
Pappa T G 4: 65,205,045 S872R possibly damaging Het
Parp4 T C 14: 56,647,349 L1295P unknown Het
Pcdh15 A T 10: 74,185,410 Y152F probably damaging Het
Phldb1 A C 9: 44,697,946 C450W probably damaging Het
Pnmal1 C CCATGATGCACCTGCTTCAACATCA 7: 16,961,451 probably benign Het
Prl2c5 G A 13: 13,185,912 G55S probably benign Het
Psme2b A T 11: 48,945,570 H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,914,449 probably benign Het
Rln3 T C 8: 84,043,302 T73A probably benign Het
Rprd1a T A 18: 24,530,005 Q21L probably damaging Het
Sept3 A T 15: 82,284,461 D155V probably damaging Het
Sh3rf3 T A 10: 58,813,768 V65E probably damaging Het
Shank3 A G 15: 89,500,390 N155S probably benign Het
Shox2 G T 3: 66,973,813 P278Q probably damaging Het
Slc1a1 T C 19: 28,879,155 probably null Het
Slc39a10 A T 1: 46,810,015 F814I probably damaging Het
Slc5a1 T C 5: 33,133,429 I119T probably damaging Het
Slc6a13 T C 6: 121,324,351 probably null Het
Spta1 A G 1: 174,213,444 D1270G probably benign Het
Spta1 T A 1: 174,217,903 F1542L probably damaging Het
Tacc3 T A 5: 33,661,224 M1K probably null Het
Tax1bp1 T C 6: 52,721,354 V17A probably damaging Het
Thegl CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,016,400 probably benign Het
Tmem156 T A 5: 65,091,547 E3D probably benign Het
Tmem209 T A 6: 30,487,418 M530L probably benign Het
Trpc2 A G 7: 102,096,226 D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,695,796 probably null Het
Uhrf2 T C 19: 30,086,391 Y585H probably damaging Het
Vmn1r26 T A 6: 58,008,720 K161N probably benign Het
Vmn1r29 A G 6: 58,307,543 S83G probably benign Het
Vps13b G T 15: 35,925,406 W3829L probably null Het
Vwce G A 19: 10,653,085 G503R probably damaging Het
Zc3h11a T C 1: 133,626,997 E415G possibly damaging Het
Zc3h14 T A 12: 98,780,282 probably null Het
Zfp119b A T 17: 55,939,499 M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,036,455 probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,036,488 probably benign Het
Zyx T A 6: 42,357,396 L518Q probably damaging Het
Other mutations in Pdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pdk1 APN 2 71895779 missense probably benign 0.00
IGL01643:Pdk1 APN 2 71897705 missense probably damaging 1.00
IGL02672:Pdk1 APN 2 71895752 missense probably damaging 1.00
IGL02833:Pdk1 APN 2 71897645 critical splice acceptor site probably null
IGL03271:Pdk1 APN 2 71880030 splice site probably benign
IGL03400:Pdk1 APN 2 71895747 missense probably benign 0.25
R0329:Pdk1 UTSW 2 71895674 splice site probably benign
R0564:Pdk1 UTSW 2 71880039 nonsense probably null
R1653:Pdk1 UTSW 2 71888995 critical splice donor site probably null
R2570:Pdk1 UTSW 2 71873560 missense possibly damaging 0.56
R5137:Pdk1 UTSW 2 71883569 missense possibly damaging 0.90
R5932:Pdk1 UTSW 2 71883416 splice site probably null
R6109:Pdk1 UTSW 2 71883506 missense probably benign 0.23
R7107:Pdk1 UTSW 2 71895741 missense probably benign 0.00
R7227:Pdk1 UTSW 2 71883901 missense possibly damaging 0.75
R7663:Pdk1 UTSW 2 71875398 splice site probably null
R8011:Pdk1 UTSW 2 71875452 missense probably benign 0.05
RF060:Pdk1 UTSW 2 71873445 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAACATTACTGCTCTTCAAAGAAGG -3'
(R):5'- ATTCTACTGGGAAGACACTCACC -3'

Sequencing Primer
(F):5'- GCAAAATACCCTCTTTACACTTAAGG -3'
(R):5'- GGGAAGACACTCACCTTACATCCTG -3'
Posted On2019-12-04