Incidental Mutation 'RF020:Shox2'
ID603774
Institutional Source Beutler Lab
Gene Symbol Shox2
Ensembl Gene ENSMUSG00000027833
Gene Nameshort stature homeobox 2
SynonymsPrx3, 6330543G17Rik, Og12x
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF020 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location66971727-66981771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66973813 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 278 (P278Q)
Ref Sequence ENSEMBL: ENSMUSP00000029422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029422] [ENSMUST00000162060] [ENSMUST00000162439] [ENSMUST00000195261]
Predicted Effect probably damaging
Transcript: ENSMUST00000029422
AA Change: P278Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029422
Gene: ENSMUSG00000027833
AA Change: P278Q

DomainStartEndE-ValueType
low complexity region 57 90 N/A INTRINSIC
HOX 140 202 1.8e-28 SMART
low complexity region 258 273 N/A INTRINSIC
Pfam:OAR 310 327 3.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162060
AA Change: P137Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125031
Gene: ENSMUSG00000027833
AA Change: P137Q

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000123838
Gene: ENSMUSG00000027833
AA Change: P186Q

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
HOX 61 123 1.8e-28 SMART
low complexity region 167 182 N/A INTRINSIC
Pfam:OAR 219 236 1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162439
AA Change: P137Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124924
Gene: ENSMUSG00000027833
AA Change: P137Q

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195261
SMART Domains Protein: ENSMUSP00000141625
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 9e-31 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice display incomplete penetrance of embryonic lethality during organogenesis and incomplete clefting of the anterior part of the palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,533,657 K1270E possibly damaging Het
Adgrb2 T C 4: 130,010,084 S668P probably damaging Het
Ahdc1 T G 4: 133,064,277 L943R possibly damaging Het
Ank2 T C 3: 126,945,476 K2253R unknown Het
Arhgap23 T C 11: 97,463,561 S767P probably damaging Het
Arhgef12 A G 9: 42,989,989 I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Btbd19 A T 4: 117,122,275 C116S probably damaging Het
Cbr1 C T 16: 93,610,179 A261V probably benign Het
Ccdc137 A G 11: 120,458,196 R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Celsr3 C T 9: 108,849,057 R3162C probably benign Het
Cep350 A T 1: 155,915,478 V1300E probably benign Het
Cluh G GCCAGAT 11: 74,669,538 probably benign Het
Cmya5 G T 13: 93,069,291 Q3357K possibly damaging Het
Col6a2 T G 10: 76,606,209 probably null Het
Cyp2j9 T A 4: 96,577,652 T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dnah6 T A 6: 73,118,057 Y2181F probably benign Het
Dnah7b A G 1: 46,373,261 D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,455,195 probably benign Het
Ep300 A T 15: 81,586,571 probably benign Het
Fam234a A G 17: 26,218,751 V90A probably benign Het
Fam71e1 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,500,535 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gal3st1 A G 11: 3,998,153 Y120C possibly damaging Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,427,149 probably null Het
Gm6665 T TC 18: 31,820,377 probably null Het
Hdlbp T C 1: 93,440,734 T8A probably benign Het
Hnrnpa2b1 T A 6: 51,466,694 K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Klhl10 C G 11: 100,442,070 Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2b CC CCTCCTGC 7: 30,586,382 probably benign Het
Krt2 A G 15: 101,817,968 I45T unknown Het
Ksr2 T C 5: 117,555,218 S244P probably benign Het
Lama5 A T 2: 180,196,178 M915K probably benign Het
Lrp1b A C 2: 41,770,846 H197Q Het
Lrrc1 T C 9: 77,452,631 E293G probably damaging Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Mgam T A 6: 40,685,309 Y1179N probably damaging Het
Mgat4c A G 10: 102,389,067 I381V probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Myc A T 15: 61,985,823 probably benign Het
Nipbl A G 15: 8,358,934 S401P probably damaging Het
Nlrp9c A T 7: 26,385,224 I310N probably benign Het
Nwd2 C A 5: 63,805,723 Y883* probably null Het
Oas1e T A 5: 120,794,318 T87S possibly damaging Het
Olfr586 A T 7: 103,121,891 C294S probably benign Het
Olfr653 A G 7: 104,580,290 M215V probably benign Het
Olfr885 G A 9: 38,061,324 M1I probably null Het
Olfr964-ps1 GA GATACA 9: 39,686,753 probably null Het
Pappa T G 4: 65,205,045 S872R possibly damaging Het
Parp4 T C 14: 56,647,349 L1295P unknown Het
Pcdh15 A T 10: 74,185,410 Y152F probably damaging Het
Pdk1 A T 2: 71,883,896 I217L possibly damaging Het
Phldb1 A C 9: 44,697,946 C450W probably damaging Het
Pnmal1 C CCATGATGCACCTGCTTCAACATCA 7: 16,961,451 probably benign Het
Prl2c5 G A 13: 13,185,912 G55S probably benign Het
Psme2b A T 11: 48,945,570 H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,914,449 probably benign Het
Rln3 T C 8: 84,043,302 T73A probably benign Het
Rprd1a T A 18: 24,530,005 Q21L probably damaging Het
Sept3 A T 15: 82,284,461 D155V probably damaging Het
Sh3rf3 T A 10: 58,813,768 V65E probably damaging Het
Shank3 A G 15: 89,500,390 N155S probably benign Het
Slc1a1 T C 19: 28,879,155 probably null Het
Slc39a10 A T 1: 46,810,015 F814I probably damaging Het
Slc5a1 T C 5: 33,133,429 I119T probably damaging Het
Slc6a13 T C 6: 121,324,351 probably null Het
Spta1 A G 1: 174,213,444 D1270G probably benign Het
Spta1 T A 1: 174,217,903 F1542L probably damaging Het
Tacc3 T A 5: 33,661,224 M1K probably null Het
Tax1bp1 T C 6: 52,721,354 V17A probably damaging Het
Thegl CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,016,400 probably benign Het
Tmem156 T A 5: 65,091,547 E3D probably benign Het
Tmem209 T A 6: 30,487,418 M530L probably benign Het
Trpc2 A G 7: 102,096,226 D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,695,796 probably null Het
Uhrf2 T C 19: 30,086,391 Y585H probably damaging Het
Vmn1r26 T A 6: 58,008,720 K161N probably benign Het
Vmn1r29 A G 6: 58,307,543 S83G probably benign Het
Vps13b G T 15: 35,925,406 W3829L probably null Het
Vwce G A 19: 10,653,085 G503R probably damaging Het
Zc3h11a T C 1: 133,626,997 E415G possibly damaging Het
Zc3h14 T A 12: 98,780,282 probably null Het
Zfp119b A T 17: 55,939,499 M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,036,455 probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,036,488 probably benign Het
Zyx T A 6: 42,357,396 L518Q probably damaging Het
Other mutations in Shox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Shox2 APN 3 66981441 missense possibly damaging 0.49
IGL00813:Shox2 APN 3 66975444 missense probably damaging 1.00
IGL01534:Shox2 APN 3 66978363 missense probably benign 0.01
IGL01583:Shox2 APN 3 66973771 unclassified probably benign
R0306:Shox2 UTSW 3 66973834 missense probably damaging 0.98
R0374:Shox2 UTSW 3 66973851 missense probably damaging 0.98
R0625:Shox2 UTSW 3 66981544 critical splice donor site probably null
R0774:Shox2 UTSW 3 66973811 missense probably damaging 1.00
R1102:Shox2 UTSW 3 66978295 missense probably damaging 1.00
R1192:Shox2 UTSW 3 66973910 nonsense probably null
R2354:Shox2 UTSW 3 66981489 missense possibly damaging 0.94
R2518:Shox2 UTSW 3 66978359 missense possibly damaging 0.83
R4163:Shox2 UTSW 3 66973771 unclassified probably benign
R4976:Shox2 UTSW 3 66973675 unclassified probably benign
R5423:Shox2 UTSW 3 66973754 unclassified probably benign
R5493:Shox2 UTSW 3 66981463 missense probably damaging 1.00
R6528:Shox2 UTSW 3 66981285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATTTTAGTCCCAAGGGCGG -3'
(R):5'- CCAAGCTGGACGCCTTTAATG -3'

Sequencing Primer
(F):5'- TTAGGAGGCTCCACCGAC -3'
(R):5'- CAAGCTGGACGCCTTTAATGTTCTG -3'
Posted On2019-12-04