Incidental Mutation 'RF020:Pappa'
ID603777
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #RF020 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65205045 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 872 (S872R)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084501
AA Change: S872R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: S872R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,533,657 K1270E possibly damaging Het
Adgrb2 T C 4: 130,010,084 S668P probably damaging Het
Ahdc1 T G 4: 133,064,277 L943R possibly damaging Het
Ank2 T C 3: 126,945,476 K2253R unknown Het
Arhgap23 T C 11: 97,463,561 S767P probably damaging Het
Arhgef12 A G 9: 42,989,989 I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Btbd19 A T 4: 117,122,275 C116S probably damaging Het
Cbr1 C T 16: 93,610,179 A261V probably benign Het
Ccdc137 A G 11: 120,458,196 R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Celsr3 C T 9: 108,849,057 R3162C probably benign Het
Cep350 A T 1: 155,915,478 V1300E probably benign Het
Cluh G GCCAGAT 11: 74,669,538 probably benign Het
Cmya5 G T 13: 93,069,291 Q3357K possibly damaging Het
Col6a2 T G 10: 76,606,209 probably null Het
Cyp2j9 T A 4: 96,577,652 T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dnah6 T A 6: 73,118,057 Y2181F probably benign Het
Dnah7b A G 1: 46,373,261 D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,455,195 probably benign Het
Ep300 A T 15: 81,586,571 probably benign Het
Fam234a A G 17: 26,218,751 V90A probably benign Het
Fam71e1 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,500,535 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gal3st1 A G 11: 3,998,153 Y120C possibly damaging Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,427,149 probably null Het
Gm6665 T TC 18: 31,820,377 probably null Het
Hdlbp T C 1: 93,440,734 T8A probably benign Het
Hnrnpa2b1 T A 6: 51,466,694 K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Klhl10 C G 11: 100,442,070 Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2b CC CCTCCTGC 7: 30,586,382 probably benign Het
Krt2 A G 15: 101,817,968 I45T unknown Het
Ksr2 T C 5: 117,555,218 S244P probably benign Het
Lama5 A T 2: 180,196,178 M915K probably benign Het
Lrp1b A C 2: 41,770,846 H197Q Het
Lrrc1 T C 9: 77,452,631 E293G probably damaging Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Mgam T A 6: 40,685,309 Y1179N probably damaging Het
Mgat4c A G 10: 102,389,067 I381V probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Myc A T 15: 61,985,823 probably benign Het
Nipbl A G 15: 8,358,934 S401P probably damaging Het
Nlrp9c A T 7: 26,385,224 I310N probably benign Het
Nwd2 C A 5: 63,805,723 Y883* probably null Het
Oas1e T A 5: 120,794,318 T87S possibly damaging Het
Olfr586 A T 7: 103,121,891 C294S probably benign Het
Olfr653 A G 7: 104,580,290 M215V probably benign Het
Olfr885 G A 9: 38,061,324 M1I probably null Het
Olfr964-ps1 GA GATACA 9: 39,686,753 probably null Het
Parp4 T C 14: 56,647,349 L1295P unknown Het
Pcdh15 A T 10: 74,185,410 Y152F probably damaging Het
Pdk1 A T 2: 71,883,896 I217L possibly damaging Het
Phldb1 A C 9: 44,697,946 C450W probably damaging Het
Pnmal1 C CCATGATGCACCTGCTTCAACATCA 7: 16,961,451 probably benign Het
Prl2c5 G A 13: 13,185,912 G55S probably benign Het
Psme2b A T 11: 48,945,570 H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,914,449 probably benign Het
Rln3 T C 8: 84,043,302 T73A probably benign Het
Rprd1a T A 18: 24,530,005 Q21L probably damaging Het
Sept3 A T 15: 82,284,461 D155V probably damaging Het
Sh3rf3 T A 10: 58,813,768 V65E probably damaging Het
Shank3 A G 15: 89,500,390 N155S probably benign Het
Shox2 G T 3: 66,973,813 P278Q probably damaging Het
Slc1a1 T C 19: 28,879,155 probably null Het
Slc39a10 A T 1: 46,810,015 F814I probably damaging Het
Slc5a1 T C 5: 33,133,429 I119T probably damaging Het
Slc6a13 T C 6: 121,324,351 probably null Het
Spta1 A G 1: 174,213,444 D1270G probably benign Het
Spta1 T A 1: 174,217,903 F1542L probably damaging Het
Tacc3 T A 5: 33,661,224 M1K probably null Het
Tax1bp1 T C 6: 52,721,354 V17A probably damaging Het
Thegl CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,016,400 probably benign Het
Tmem156 T A 5: 65,091,547 E3D probably benign Het
Tmem209 T A 6: 30,487,418 M530L probably benign Het
Trpc2 A G 7: 102,096,226 D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,695,796 probably null Het
Uhrf2 T C 19: 30,086,391 Y585H probably damaging Het
Vmn1r26 T A 6: 58,008,720 K161N probably benign Het
Vmn1r29 A G 6: 58,307,543 S83G probably benign Het
Vps13b G T 15: 35,925,406 W3829L probably null Het
Vwce G A 19: 10,653,085 G503R probably damaging Het
Zc3h11a T C 1: 133,626,997 E415G possibly damaging Het
Zc3h14 T A 12: 98,780,282 probably null Het
Zfp119b A T 17: 55,939,499 M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,036,455 probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,036,488 probably benign Het
Zyx T A 6: 42,357,396 L518Q probably damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
mama UTSW 4 65204867 missense possibly damaging 0.94
Revisitation UTSW 4 65294468 missense probably damaging 0.96
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
R7410:Pappa UTSW 4 65335719 missense probably damaging 1.00
R7457:Pappa UTSW 4 65189266 missense probably damaging 1.00
R7506:Pappa UTSW 4 65231182 missense probably benign 0.00
R7546:Pappa UTSW 4 65156115 missense possibly damaging 0.48
R7975:Pappa UTSW 4 65294468 missense probably damaging 0.96
R8111:Pappa UTSW 4 65261992 missense probably damaging 0.99
R8260:Pappa UTSW 4 65316182 missense probably damaging 0.99
R8347:Pappa UTSW 4 65327065 missense probably damaging 1.00
R8520:Pappa UTSW 4 65335764 missense probably benign 0.01
R8812:Pappa UTSW 4 65204929 missense possibly damaging 0.94
R8815:Pappa UTSW 4 65181110 missense probably benign 0.00
RF006:Pappa UTSW 4 65323873 missense probably benign 0.00
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Z1177:Pappa UTSW 4 65307758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGAGCTGTCAATGACATC -3'
(R):5'- GAACTTTCTCCTTTTCGGTCAAGAC -3'

Sequencing Primer
(F):5'- GTGGAGCTGTCAATGACATCAAACTC -3'
(R):5'- AAGACCTTCTGACTTTCCCCACATC -3'
Posted On2019-12-04