Incidental Mutation 'RF020:Cyp3a13'
ID603789
Institutional Source Beutler Lab
Gene Symbol Cyp3a13
Ensembl Gene ENSMUSG00000029727
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 13
Synonymssteroid inducible, IIIAm2
Accession Numbers

Genbank: NM_007819

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF020 (G1)
Quality Score163.457
Status Not validated
Chromosome5
Chromosomal Location137892932-137921619 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) CATTATT to CATT at 137894263 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031741]
Predicted Effect probably null
Transcript: ENSMUST00000031741
SMART Domains Protein: ENSMUSP00000031741
Gene: ENSMUSG00000029727

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
Pfam:p450 38 493 1.3e-130 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes, which participate in drug metabolism and the synthesis of cholesterol, steroids and other lipids. This enzyme hydroxylates testosterone and dehydroepiandrosterone 3-sulphate, which is involved in the formation of estriol during pregnancy. This gene is part of a cluster of related genes on chromosome 7q21.1. Naturally-occurring readthrough transcription occurs between this gene and the downstream CYP3A51P pseudogene and is represented by GeneID:100861540. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show no apparent alterations in hematology, plasma clinical chemistry or pathology. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,533,657 K1270E possibly damaging Het
Adgrb2 T C 4: 130,010,084 S668P probably damaging Het
Ahdc1 T G 4: 133,064,277 L943R possibly damaging Het
Ank2 T C 3: 126,945,476 K2253R unknown Het
Arhgap23 T C 11: 97,463,561 S767P probably damaging Het
Arhgef12 A G 9: 42,989,989 I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Btbd19 A T 4: 117,122,275 C116S probably damaging Het
Cbr1 C T 16: 93,610,179 A261V probably benign Het
Ccdc137 A G 11: 120,458,196 R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Celsr3 C T 9: 108,849,057 R3162C probably benign Het
Cep350 A T 1: 155,915,478 V1300E probably benign Het
Cluh G GCCAGAT 11: 74,669,538 probably benign Het
Cmya5 G T 13: 93,069,291 Q3357K possibly damaging Het
Col6a2 T G 10: 76,606,209 probably null Het
Cyp2j9 T A 4: 96,577,652 T315S probably damaging Het
Dnah6 T A 6: 73,118,057 Y2181F probably benign Het
Dnah7b A G 1: 46,373,261 D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,455,195 probably benign Het
Ep300 A T 15: 81,586,571 probably benign Het
Fam234a A G 17: 26,218,751 V90A probably benign Het
Fam71e1 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,500,535 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gal3st1 A G 11: 3,998,153 Y120C possibly damaging Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,427,149 probably null Het
Gm6665 T TC 18: 31,820,377 probably null Het
Hdlbp T C 1: 93,440,734 T8A probably benign Het
Hnrnpa2b1 T A 6: 51,466,694 K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Klhl10 C G 11: 100,442,070 Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2b CC CCTCCTGC 7: 30,586,382 probably benign Het
Krt2 A G 15: 101,817,968 I45T unknown Het
Ksr2 T C 5: 117,555,218 S244P probably benign Het
Lama5 A T 2: 180,196,178 M915K probably benign Het
Lrp1b A C 2: 41,770,846 H197Q Het
Lrrc1 T C 9: 77,452,631 E293G probably damaging Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Mgam T A 6: 40,685,309 Y1179N probably damaging Het
Mgat4c A G 10: 102,389,067 I381V probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Myc A T 15: 61,985,823 probably benign Het
Nipbl A G 15: 8,358,934 S401P probably damaging Het
Nlrp9c A T 7: 26,385,224 I310N probably benign Het
Nwd2 C A 5: 63,805,723 Y883* probably null Het
Oas1e T A 5: 120,794,318 T87S possibly damaging Het
Olfr586 A T 7: 103,121,891 C294S probably benign Het
Olfr653 A G 7: 104,580,290 M215V probably benign Het
Olfr885 G A 9: 38,061,324 M1I probably null Het
Olfr964-ps1 GA GATACA 9: 39,686,753 probably null Het
Pappa T G 4: 65,205,045 S872R possibly damaging Het
Parp4 T C 14: 56,647,349 L1295P unknown Het
Pcdh15 A T 10: 74,185,410 Y152F probably damaging Het
Pdk1 A T 2: 71,883,896 I217L possibly damaging Het
Phldb1 A C 9: 44,697,946 C450W probably damaging Het
Pnmal1 C CCATGATGCACCTGCTTCAACATCA 7: 16,961,451 probably benign Het
Prl2c5 G A 13: 13,185,912 G55S probably benign Het
Psme2b A T 11: 48,945,570 H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,914,449 probably benign Het
Rln3 T C 8: 84,043,302 T73A probably benign Het
Rprd1a T A 18: 24,530,005 Q21L probably damaging Het
Sept3 A T 15: 82,284,461 D155V probably damaging Het
Sh3rf3 T A 10: 58,813,768 V65E probably damaging Het
Shank3 A G 15: 89,500,390 N155S probably benign Het
Shox2 G T 3: 66,973,813 P278Q probably damaging Het
Slc1a1 T C 19: 28,879,155 probably null Het
Slc39a10 A T 1: 46,810,015 F814I probably damaging Het
Slc5a1 T C 5: 33,133,429 I119T probably damaging Het
Slc6a13 T C 6: 121,324,351 probably null Het
Spta1 A G 1: 174,213,444 D1270G probably benign Het
Spta1 T A 1: 174,217,903 F1542L probably damaging Het
Tacc3 T A 5: 33,661,224 M1K probably null Het
Tax1bp1 T C 6: 52,721,354 V17A probably damaging Het
Thegl CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,016,400 probably benign Het
Tmem156 T A 5: 65,091,547 E3D probably benign Het
Tmem209 T A 6: 30,487,418 M530L probably benign Het
Trpc2 A G 7: 102,096,226 D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,695,796 probably null Het
Uhrf2 T C 19: 30,086,391 Y585H probably damaging Het
Vmn1r26 T A 6: 58,008,720 K161N probably benign Het
Vmn1r29 A G 6: 58,307,543 S83G probably benign Het
Vps13b G T 15: 35,925,406 W3829L probably null Het
Vwce G A 19: 10,653,085 G503R probably damaging Het
Zc3h11a T C 1: 133,626,997 E415G possibly damaging Het
Zc3h14 T A 12: 98,780,282 probably null Het
Zfp119b A T 17: 55,939,499 M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,036,455 probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,036,488 probably benign Het
Zyx T A 6: 42,357,396 L518Q probably damaging Het
Other mutations in Cyp3a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Cyp3a13 APN 5 137911933 missense probably benign 0.08
IGL01879:Cyp3a13 APN 5 137919003 missense probably benign
IGL01886:Cyp3a13 APN 5 137898820 missense probably damaging 1.00
IGL02048:Cyp3a13 APN 5 137918995 splice site probably benign
IGL02102:Cyp3a13 APN 5 137911603 missense probably benign 0.00
IGL02285:Cyp3a13 APN 5 137909967 missense probably benign 0.38
IGL03213:Cyp3a13 APN 5 137894267 utr 3 prime probably benign
IGL03238:Cyp3a13 APN 5 137898889 missense probably damaging 0.99
G4846:Cyp3a13 UTSW 5 137898823 missense possibly damaging 0.55
IGL02988:Cyp3a13 UTSW 5 137899010 nonsense probably null
PIT4486001:Cyp3a13 UTSW 5 137909966 missense probably benign 0.17
R0319:Cyp3a13 UTSW 5 137898862 missense probably damaging 1.00
R1024:Cyp3a13 UTSW 5 137894364 missense possibly damaging 0.56
R1189:Cyp3a13 UTSW 5 137911630 splice site probably null
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1464:Cyp3a13 UTSW 5 137905565 missense possibly damaging 0.83
R1501:Cyp3a13 UTSW 5 137911630 splice site probably null
R1838:Cyp3a13 UTSW 5 137911632 splice site probably null
R1956:Cyp3a13 UTSW 5 137909942 missense probably benign 0.02
R1981:Cyp3a13 UTSW 5 137911856 missense probably damaging 0.97
R2048:Cyp3a13 UTSW 5 137909975 missense probably damaging 0.98
R2140:Cyp3a13 UTSW 5 137921454 missense possibly damaging 0.93
R4844:Cyp3a13 UTSW 5 137917551 missense probably benign
R5001:Cyp3a13 UTSW 5 137898916 missense probably benign 0.00
R5062:Cyp3a13 UTSW 5 137898899 missense possibly damaging 0.52
R5420:Cyp3a13 UTSW 5 137898981 missense probably damaging 1.00
R5855:Cyp3a13 UTSW 5 137919056 missense probably damaging 0.98
R6089:Cyp3a13 UTSW 5 137909953 missense probably benign 0.07
R6927:Cyp3a13 UTSW 5 137895284 missense probably damaging 1.00
R6978:Cyp3a13 UTSW 5 137905539 missense probably benign 0.01
R7283:Cyp3a13 UTSW 5 137905556 missense probably benign 0.01
R7571:Cyp3a13 UTSW 5 137898863 missense possibly damaging 0.93
R7781:Cyp3a13 UTSW 5 137898874 missense possibly damaging 0.94
RF007:Cyp3a13 UTSW 5 137894263 makesense probably null
X0024:Cyp3a13 UTSW 5 137900391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGAACCAGGGAGTTG -3'
(R):5'- AGGTTTTGTGCACTTGTAAAGC -3'

Sequencing Primer
(F):5'- GAACCAGGGAGTTGGATATATTTATC -3'
(R):5'- GTGCACTTGTAAAGCACTTTTAGC -3'
Posted On2019-12-04