Incidental Mutation 'RF020:Mgam'
ID603791
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
Synonyms6030407P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #RF020 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40685309 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1179 (Y1179N)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202966]
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: Y1179N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: Y1179N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: Y1179N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: Y1179N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,533,657 K1270E possibly damaging Het
Adgrb2 T C 4: 130,010,084 S668P probably damaging Het
Ahdc1 T G 4: 133,064,277 L943R possibly damaging Het
Ank2 T C 3: 126,945,476 K2253R unknown Het
Arhgap23 T C 11: 97,463,561 S767P probably damaging Het
Arhgef12 A G 9: 42,989,989 I839T possibly damaging Het
Begain CGCCGC CGCCGCGGCCGC 12: 109,033,424 probably benign Het
Btbd19 A T 4: 117,122,275 C116S probably damaging Het
Cbr1 C T 16: 93,610,179 A261V probably benign Het
Ccdc137 A G 11: 120,458,196 R18G probably benign Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Celsr3 C T 9: 108,849,057 R3162C probably benign Het
Cep350 A T 1: 155,915,478 V1300E probably benign Het
Cluh G GCCAGAT 11: 74,669,538 probably benign Het
Cmya5 G T 13: 93,069,291 Q3357K possibly damaging Het
Col6a2 T G 10: 76,606,209 probably null Het
Cyp2j9 T A 4: 96,577,652 T315S probably damaging Het
Cyp3a13 CATTATT CATT 5: 137,894,263 probably null Het
Dnah6 T A 6: 73,118,057 Y2181F probably benign Het
Dnah7b A G 1: 46,373,261 D4010G possibly damaging Het
E4f1 CCG CCGACG 17: 24,455,195 probably benign Het
Ep300 A T 15: 81,586,571 probably benign Het
Fam234a A G 17: 26,218,751 V90A probably benign Het
Fam71e1 GGA GGAAGGGTGGATCCTGGATACCTGGGTCTGAGGGAAGA 7: 44,500,535 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gal3st1 A G 11: 3,998,153 Y120C possibly damaging Het
Gm5475 GTGGAAGGAAAGGT G 15: 100,427,149 probably null Het
Gm6665 T TC 18: 31,820,377 probably null Het
Hdlbp T C 1: 93,440,734 T8A probably benign Het
Hnrnpa2b1 T A 6: 51,466,694 K92N probably damaging Het
Hsdl2 GGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC GGAGCAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,640 probably benign Het
Klhl10 C G 11: 100,442,070 Q14E probably benign Het
Klra2 GAAAGAAATCCA GAAAGAAATCCAAAGAAATCCA 6: 131,221,838 probably null Het
Kmt2b CC CCTCCTGC 7: 30,586,382 probably benign Het
Krt2 A G 15: 101,817,968 I45T unknown Het
Ksr2 T C 5: 117,555,218 S244P probably benign Het
Lama5 A T 2: 180,196,178 M915K probably benign Het
Lrp1b A C 2: 41,770,846 H197Q Het
Lrrc1 T C 9: 77,452,631 E293G probably damaging Het
Med12l AACA AACAACA 3: 59,275,958 probably benign Het
Mgat4c A G 10: 102,389,067 I381V probably benign Het
Mrgprx1 A AGAC 7: 48,021,511 probably benign Het
Myc A T 15: 61,985,823 probably benign Het
Nipbl A G 15: 8,358,934 S401P probably damaging Het
Nlrp9c A T 7: 26,385,224 I310N probably benign Het
Nwd2 C A 5: 63,805,723 Y883* probably null Het
Oas1e T A 5: 120,794,318 T87S possibly damaging Het
Olfr586 A T 7: 103,121,891 C294S probably benign Het
Olfr653 A G 7: 104,580,290 M215V probably benign Het
Olfr885 G A 9: 38,061,324 M1I probably null Het
Olfr964-ps1 GA GATACA 9: 39,686,753 probably null Het
Pappa T G 4: 65,205,045 S872R possibly damaging Het
Parp4 T C 14: 56,647,349 L1295P unknown Het
Pcdh15 A T 10: 74,185,410 Y152F probably damaging Het
Pdk1 A T 2: 71,883,896 I217L possibly damaging Het
Phldb1 A C 9: 44,697,946 C450W probably damaging Het
Pnmal1 C CCATGATGCACCTGCTTCAACATCA 7: 16,961,451 probably benign Het
Prl2c5 G A 13: 13,185,912 G55S probably benign Het
Psme2b A T 11: 48,945,570 H183Q probably damaging Het
Ptms CCTCCTC CCTCCTCCTC 6: 124,914,449 probably benign Het
Rln3 T C 8: 84,043,302 T73A probably benign Het
Rprd1a T A 18: 24,530,005 Q21L probably damaging Het
Sept3 A T 15: 82,284,461 D155V probably damaging Het
Sh3rf3 T A 10: 58,813,768 V65E probably damaging Het
Shank3 A G 15: 89,500,390 N155S probably benign Het
Shox2 G T 3: 66,973,813 P278Q probably damaging Het
Slc1a1 T C 19: 28,879,155 probably null Het
Slc39a10 A T 1: 46,810,015 F814I probably damaging Het
Slc5a1 T C 5: 33,133,429 I119T probably damaging Het
Slc6a13 T C 6: 121,324,351 probably null Het
Spta1 A G 1: 174,213,444 D1270G probably benign Het
Spta1 T A 1: 174,217,903 F1542L probably damaging Het
Tacc3 T A 5: 33,661,224 M1K probably null Het
Tax1bp1 T C 6: 52,721,354 V17A probably damaging Het
Thegl CAGCGATCCTCCCCAGTCCCGCAAGGC CAGCGATCCTCCCCAGTCCCGCAAGGCGAGCGATCCTCCCCAGTCCCGCAAGGC 5: 77,016,400 probably benign Het
Tmem156 T A 5: 65,091,547 E3D probably benign Het
Tmem209 T A 6: 30,487,418 M530L probably benign Het
Trpc2 A G 7: 102,096,226 D883G unknown Het
Tsen34 GGAGCCAAAAT G 7: 3,695,796 probably null Het
Uhrf2 T C 19: 30,086,391 Y585H probably damaging Het
Vmn1r26 T A 6: 58,008,720 K161N probably benign Het
Vmn1r29 A G 6: 58,307,543 S83G probably benign Het
Vps13b G T 15: 35,925,406 W3829L probably null Het
Vwce G A 19: 10,653,085 G503R probably damaging Het
Zc3h11a T C 1: 133,626,997 E415G possibly damaging Het
Zc3h14 T A 12: 98,780,282 probably null Het
Zfp119b A T 17: 55,939,499 M229K probably benign Het
Zfp384 CCAAGCTCAAGC CCAAGC 6: 125,036,455 probably benign Het
Zfp384 GGCCCAGGC GGCCCAGGCCCACGCCCAGGC 6: 125,036,488 probably benign Het
Zyx T A 6: 42,357,396 L518Q probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 unclassified probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 intron probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 intron probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7942:Mgam UTSW 6 40740179 missense possibly damaging 0.75
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCCAAAATGGAAGCATGCTTG -3'
(R):5'- ATGGATGCATGCTTTGGAAC -3'

Sequencing Primer
(F):5'- GTGTGGGTTAACTGCAGAGTACC -3'
(R):5'- CACAAAATGTGCTGAATAATGGGATC -3'
Posted On2019-12-04