Incidental Mutation 'RF021:Diexf'
Institutional Source Beutler Lab
Gene Symbol Diexf
Ensembl Gene ENSMUSG00000016181
Gene Namedigestive organ expansion factor homolog (zebrafish)
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosomal Location193091104-193130272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193120666 bp
Amino Acid Change Phenylalanine to Leucine at position 248 (F248L)
Ref Sequence ENSEMBL: ENSMUSP00000082691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000193460] [ENSMUST00000195291] [ENSMUST00000195848]
Predicted Effect probably benign
Transcript: ENSMUST00000085555
AA Change: F248L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181
AA Change: F248L

low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193460
SMART Domains Protein: ENSMUSP00000142059
Gene: ENSMUSG00000016181

Pfam:DUF1253 1 205 6.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195291
AA Change: F248L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181
AA Change: F248L

low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:DUF1253 325 634 6.9e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195848
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Diexf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Diexf APN 1 193115001 missense probably damaging 1.00
IGL01700:Diexf APN 1 193118265 missense probably damaging 1.00
IGL02076:Diexf APN 1 193130059 missense probably damaging 1.00
IGL02121:Diexf APN 1 193118278 missense probably benign 0.05
IGL02666:Diexf APN 1 193107596 nonsense probably null
IGL02997:Diexf APN 1 193120584 missense probably benign 0.34
3-1:Diexf UTSW 1 193118280 missense probably benign 0.07
R0099:Diexf UTSW 1 193128470 missense probably damaging 1.00
R0395:Diexf UTSW 1 193123676 missense possibly damaging 0.69
R0502:Diexf UTSW 1 193114828 splice site probably benign
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0974:Diexf UTSW 1 193114703 missense probably damaging 0.98
R1815:Diexf UTSW 1 193118283 missense probably benign 0.26
R1930:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1931:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1937:Diexf UTSW 1 193122093 missense probably damaging 1.00
R2847:Diexf UTSW 1 193128451 missense probably benign 0.41
R2848:Diexf UTSW 1 193128451 missense probably benign 0.41
R3412:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R3414:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R4471:Diexf UTSW 1 193130137 missense possibly damaging 0.68
R4627:Diexf UTSW 1 193107695 missense probably benign 0.00
R4644:Diexf UTSW 1 193128480 missense probably damaging 1.00
R4761:Diexf UTSW 1 193113922 missense probably damaging 1.00
R4791:Diexf UTSW 1 193128267 missense probably benign
R4793:Diexf UTSW 1 193113808 missense probably null 0.56
R4858:Diexf UTSW 1 193113764 missense probably damaging 1.00
R4944:Diexf UTSW 1 193114954 missense probably damaging 1.00
R5162:Diexf UTSW 1 193113781 missense probably damaging 1.00
R5347:Diexf UTSW 1 193128379 missense probably benign
R5837:Diexf UTSW 1 193118393 missense probably damaging 1.00
R6113:Diexf UTSW 1 193129502 missense probably null 0.01
R6455:Diexf UTSW 1 193128376 missense probably benign 0.07
R6563:Diexf UTSW 1 193118390 missense probably damaging 1.00
R6636:Diexf UTSW 1 193113767 missense probably damaging 1.00
R7018:Diexf UTSW 1 193114855 missense probably benign 0.06
R7037:Diexf UTSW 1 193120723 splice site probably null
R8027:Diexf UTSW 1 193118222 missense probably benign
R8042:Diexf UTSW 1 193114672 missense
R8092:Diexf UTSW 1 193120363 missense probably benign 0.00
R8243:Diexf UTSW 1 193114629 missense probably benign
R8691:Diexf UTSW 1 193113802 missense probably benign 0.41
X0050:Diexf UTSW 1 193123732 missense probably benign 0.23
Z1177:Diexf UTSW 1 193114675 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04