Incidental Mutation 'RF021:Med12l'
ID 603868
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Name mediator complex subunit 12-like
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.308) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 58913246-59226103 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58980711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 359 (F359S)
Ref Sequence ENSEMBL: ENSMUSP00000041859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029393] [ENSMUST00000040325] [ENSMUST00000040846] [ENSMUST00000164225] [ENSMUST00000199659]
AlphaFold Q8BQM9
Predicted Effect probably benign
Transcript: ENSMUST00000029393
AA Change: F359S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029393
Gene: ENSMUSG00000056476
AA Change: F359S

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 737 1.6e-200 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000040325
AA Change: F348S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: F348S

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040846
AA Change: F359S

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041859
Gene: ENSMUSG00000056476
AA Change: F359S

DomainStartEndE-ValueType
Med12 101 172 1.54e-17 SMART
low complexity region 227 235 N/A INTRINSIC
low complexity region 280 289 N/A INTRINSIC
Pfam:Med12-LCEWAV 293 728 9e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
AA Change: F348S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: F348S

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199659
AA Change: F348S

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: F348S

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 58,949,757 (GRCm39) missense probably damaging 0.98
IGL00561:Med12l APN 3 59,135,245 (GRCm39) missense probably benign
IGL00974:Med12l APN 3 58,990,435 (GRCm39) missense probably damaging 1.00
IGL01024:Med12l APN 3 58,980,762 (GRCm39) missense probably damaging 1.00
IGL01094:Med12l APN 3 59,001,076 (GRCm39) missense probably damaging 0.99
IGL01134:Med12l APN 3 58,949,696 (GRCm39) missense possibly damaging 0.91
IGL01535:Med12l APN 3 59,169,680 (GRCm39) missense probably damaging 1.00
IGL01653:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL01735:Med12l APN 3 59,170,675 (GRCm39) missense probably damaging 1.00
IGL01972:Med12l APN 3 59,169,314 (GRCm39) missense probably damaging 1.00
IGL02005:Med12l APN 3 59,152,368 (GRCm39) missense probably damaging 1.00
IGL02098:Med12l APN 3 59,183,276 (GRCm39) missense possibly damaging 0.92
IGL02115:Med12l APN 3 58,975,740 (GRCm39) missense probably benign 0.00
IGL02231:Med12l APN 3 59,153,303 (GRCm39) missense probably damaging 1.00
IGL02259:Med12l APN 3 59,153,264 (GRCm39) missense probably damaging 1.00
IGL02369:Med12l APN 3 59,164,794 (GRCm39) missense probably benign 0.00
IGL02424:Med12l APN 3 59,000,143 (GRCm39) missense probably benign 0.21
IGL02501:Med12l APN 3 59,169,397 (GRCm39) missense possibly damaging 0.71
IGL02525:Med12l APN 3 58,975,789 (GRCm39) missense probably benign 0.01
IGL02530:Med12l APN 3 58,984,510 (GRCm39) missense probably damaging 1.00
IGL02735:Med12l APN 3 59,001,067 (GRCm39) missense probably damaging 1.00
IGL02865:Med12l APN 3 59,201,713 (GRCm39) missense probably damaging 1.00
IGL03183:Med12l APN 3 58,944,976 (GRCm39) splice site probably null
IGL03264:Med12l APN 3 59,208,788 (GRCm39) nonsense probably null
FR4304:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4340:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,415 (GRCm39) small insertion probably benign
FR4342:Med12l UTSW 3 59,183,409 (GRCm39) small insertion probably benign
FR4449:Med12l UTSW 3 59,183,384 (GRCm39) nonsense probably null
FR4548:Med12l UTSW 3 59,183,403 (GRCm39) small insertion probably benign
FR4589:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
FR4976:Med12l UTSW 3 59,183,398 (GRCm39) small insertion probably benign
P0007:Med12l UTSW 3 58,998,816 (GRCm39) splice site probably benign
P0045:Med12l UTSW 3 58,998,956 (GRCm39) missense probably damaging 0.99
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0030:Med12l UTSW 3 59,156,076 (GRCm39) missense probably damaging 1.00
R0148:Med12l UTSW 3 58,945,075 (GRCm39) missense probably damaging 1.00
R0325:Med12l UTSW 3 58,984,480 (GRCm39) missense possibly damaging 0.88
R0330:Med12l UTSW 3 59,135,123 (GRCm39) missense probably damaging 1.00
R0388:Med12l UTSW 3 59,000,925 (GRCm39) splice site probably benign
R0542:Med12l UTSW 3 58,949,822 (GRCm39) missense probably damaging 1.00
R0624:Med12l UTSW 3 58,945,123 (GRCm39) nonsense probably null
R0625:Med12l UTSW 3 59,154,858 (GRCm39) missense probably damaging 1.00
R0671:Med12l UTSW 3 59,172,350 (GRCm39) missense probably damaging 1.00
R0706:Med12l UTSW 3 59,169,401 (GRCm39) missense probably damaging 1.00
R0785:Med12l UTSW 3 59,168,253 (GRCm39) missense probably damaging 1.00
R1054:Med12l UTSW 3 59,156,072 (GRCm39) missense probably damaging 0.99
R1102:Med12l UTSW 3 59,152,257 (GRCm39) missense probably damaging 0.99
R1391:Med12l UTSW 3 58,945,159 (GRCm39) missense probably benign 0.00
R1501:Med12l UTSW 3 59,168,256 (GRCm39) critical splice donor site probably null
R1544:Med12l UTSW 3 59,172,661 (GRCm39) missense possibly damaging 0.71
R1662:Med12l UTSW 3 59,001,038 (GRCm39) missense probably damaging 1.00
R1670:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
R1839:Med12l UTSW 3 58,975,740 (GRCm39) missense probably benign
R1854:Med12l UTSW 3 59,168,193 (GRCm39) missense probably damaging 1.00
R2045:Med12l UTSW 3 59,169,731 (GRCm39) nonsense probably null
R2070:Med12l UTSW 3 59,152,326 (GRCm39) missense probably damaging 1.00
R2132:Med12l UTSW 3 59,172,703 (GRCm39) splice site probably null
R2290:Med12l UTSW 3 59,152,359 (GRCm39) missense probably damaging 1.00
R2325:Med12l UTSW 3 59,139,875 (GRCm39) missense probably damaging 0.99
R2352:Med12l UTSW 3 59,148,113 (GRCm39) missense probably damaging 1.00
R2484:Med12l UTSW 3 59,205,259 (GRCm39) missense probably benign 0.18
R2906:Med12l UTSW 3 59,164,503 (GRCm39) missense probably damaging 1.00
R3735:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3736:Med12l UTSW 3 58,998,916 (GRCm39) missense probably damaging 1.00
R3774:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R3957:Med12l UTSW 3 58,980,589 (GRCm39) missense probably damaging 0.99
R4020:Med12l UTSW 3 59,155,363 (GRCm39) missense probably damaging 0.97
R4087:Med12l UTSW 3 59,205,342 (GRCm39) missense probably benign 0.00
R4231:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4233:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4235:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4236:Med12l UTSW 3 59,164,644 (GRCm39) splice site probably null
R4327:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4328:Med12l UTSW 3 59,172,688 (GRCm39) missense probably benign 0.01
R4346:Med12l UTSW 3 58,938,976 (GRCm39) missense probably damaging 1.00
R4543:Med12l UTSW 3 58,998,929 (GRCm39) missense probably damaging 1.00
R4559:Med12l UTSW 3 58,914,523 (GRCm39) critical splice donor site probably null
R4776:Med12l UTSW 3 59,140,633 (GRCm39) missense probably damaging 1.00
R4877:Med12l UTSW 3 59,152,214 (GRCm39) missense probably damaging 1.00
R4983:Med12l UTSW 3 59,169,350 (GRCm39) missense probably damaging 1.00
R5114:Med12l UTSW 3 59,167,109 (GRCm39) missense possibly damaging 0.85
R5125:Med12l UTSW 3 59,174,635 (GRCm39) missense possibly damaging 0.83
R5230:Med12l UTSW 3 59,153,209 (GRCm39) missense probably damaging 1.00
R5407:Med12l UTSW 3 59,165,622 (GRCm39) missense probably damaging 1.00
R5426:Med12l UTSW 3 59,156,143 (GRCm39) missense probably damaging 0.98
R5439:Med12l UTSW 3 59,170,634 (GRCm39) missense probably null 1.00
R5449:Med12l UTSW 3 59,167,127 (GRCm39) missense probably damaging 1.00
R5596:Med12l UTSW 3 59,159,771 (GRCm39) missense probably benign 0.45
R5716:Med12l UTSW 3 59,208,798 (GRCm39) critical splice donor site probably null
R5833:Med12l UTSW 3 59,172,647 (GRCm39) missense possibly damaging 0.95
R5883:Med12l UTSW 3 58,998,889 (GRCm39) missense probably damaging 1.00
R6264:Med12l UTSW 3 59,163,423 (GRCm39) missense probably damaging 1.00
R6269:Med12l UTSW 3 59,135,243 (GRCm39) missense probably damaging 1.00
R6394:Med12l UTSW 3 59,142,508 (GRCm39) missense probably damaging 1.00
R6400:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R6475:Med12l UTSW 3 59,164,500 (GRCm39) missense probably damaging 1.00
R6489:Med12l UTSW 3 59,164,828 (GRCm39) missense probably damaging 0.99
R6654:Med12l UTSW 3 59,169,713 (GRCm39) missense probably damaging 1.00
R6881:Med12l UTSW 3 59,174,586 (GRCm39) missense probably benign 0.00
R7110:Med12l UTSW 3 59,169,645 (GRCm39) missense possibly damaging 0.92
R7134:Med12l UTSW 3 59,001,180 (GRCm39) nonsense probably null
R7137:Med12l UTSW 3 59,165,675 (GRCm39) missense probably damaging 1.00
R7159:Med12l UTSW 3 59,183,438 (GRCm39) missense probably benign
R7341:Med12l UTSW 3 58,949,824 (GRCm39) missense possibly damaging 0.53
R7349:Med12l UTSW 3 59,165,746 (GRCm39) missense probably damaging 1.00
R7413:Med12l UTSW 3 58,998,971 (GRCm39) missense probably benign 0.00
R7495:Med12l UTSW 3 59,152,194 (GRCm39) missense probably damaging 1.00
R7678:Med12l UTSW 3 58,984,141 (GRCm39) missense probably damaging 1.00
R7697:Med12l UTSW 3 59,148,078 (GRCm39) missense probably damaging 1.00
R7714:Med12l UTSW 3 59,001,007 (GRCm39) missense probably benign 0.17
R7725:Med12l UTSW 3 59,163,413 (GRCm39) missense probably damaging 1.00
R7846:Med12l UTSW 3 59,172,355 (GRCm39) missense probably damaging 1.00
R7852:Med12l UTSW 3 59,155,332 (GRCm39) missense probably damaging 1.00
R8080:Med12l UTSW 3 59,172,607 (GRCm39) missense probably damaging 1.00
R8181:Med12l UTSW 3 59,169,389 (GRCm39) missense probably damaging 1.00
R8223:Med12l UTSW 3 58,993,784 (GRCm39) missense possibly damaging 0.79
R8560:Med12l UTSW 3 58,945,026 (GRCm39) missense probably damaging 1.00
R8708:Med12l UTSW 3 59,159,751 (GRCm39) missense probably benign 0.00
R8865:Med12l UTSW 3 58,979,303 (GRCm39) missense probably benign
R8947:Med12l UTSW 3 58,984,443 (GRCm39) splice site probably benign
R8976:Med12l UTSW 3 59,183,329 (GRCm39) missense probably damaging 0.99
R9016:Med12l UTSW 3 59,163,294 (GRCm39) missense probably damaging 0.96
R9183:Med12l UTSW 3 58,984,498 (GRCm39) missense probably damaging 1.00
R9487:Med12l UTSW 3 59,155,353 (GRCm39) missense probably benign
R9526:Med12l UTSW 3 58,984,207 (GRCm39) missense probably damaging 0.96
R9802:Med12l UTSW 3 59,169,346 (GRCm39) missense probably damaging 1.00
RF004:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF011:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF013:Med12l UTSW 3 59,183,387 (GRCm39) small insertion probably benign
RF020:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF027:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF030:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF032:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,408 (GRCm39) small insertion probably benign
RF033:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF037:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,410 (GRCm39) small insertion probably benign
RF040:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF041:Med12l UTSW 3 59,183,406 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,402 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,388 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,377 (GRCm39) small insertion probably benign
RF042:Med12l UTSW 3 59,183,416 (GRCm39) small insertion probably benign
RF049:Med12l UTSW 3 59,183,390 (GRCm39) small insertion probably benign
RF050:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF053:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF055:Med12l UTSW 3 59,183,404 (GRCm39) small insertion probably benign
RF056:Med12l UTSW 3 59,183,414 (GRCm39) small insertion probably benign
RF057:Med12l UTSW 3 59,183,401 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,394 (GRCm39) small insertion probably benign
RF063:Med12l UTSW 3 59,183,379 (GRCm39) small insertion probably benign
X0062:Med12l UTSW 3 59,140,600 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 59,203,538 (GRCm39) missense probably benign 0.00
Z1176:Med12l UTSW 3 59,152,364 (GRCm39) missense probably damaging 1.00
Z1176:Med12l UTSW 3 58,998,838 (GRCm39) missense probably damaging 0.98
Z1177:Med12l UTSW 3 59,155,296 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACATGACTGCTTTCTGCC -3'
(R):5'- CTCTCAGTGTGATCTAACGAACAG -3'

Sequencing Primer
(F):5'- CAGATGAGTTTGTTCAGTCAGCCTAC -3'
(R):5'- CGAACAGAAATAGATCGTTGATTTCC -3'
Posted On 2019-12-04