Incidental Mutation 'RF021:Lce1m'
ID 603869
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Name late cornified envelope 1M
Synonyms Sprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock # RF021 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 93017810-93019060 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) GCTGCCACC to GCTGCCACCACTTCTGCCACC at 93018269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
AlphaFold Q9CR91
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 splice site probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF030:Lce1m UTSW 3 93018344 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCGTGGCCAGGTC -3'
(R):5'- TGGAGATGTCCTGTCAGCAG -3'

Sequencing Primer
(F):5'- GGTCAGCAGCAACCTCCAGAG -3'
(R):5'- ATGTCCTGTCAGCAGAGCCAG -3'
Posted On 2019-12-04