Incidental Mutation 'RF021:Stpg2'
ID603871
Institutional Source Beutler Lab
Gene Symbol Stpg2
Ensembl Gene ENSMUSG00000047940
Gene Namesperm tail PG rich repeat containing 2
SynonymsLOC381476, B930007M17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #RF021 (G1)
Quality Score113.008
Status Validated
Chromosome3
Chromosomal Location139205694-139710299 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 139212250 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062306] [ENSMUST00000106239]
Predicted Effect probably null
Transcript: ENSMUST00000062306
SMART Domains Protein: ENSMUSP00000051539
Gene: ENSMUSG00000047940

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 20 50 1.1e1 PFAM
Pfam:SHIPPO-rpt 62 92 1.3e1 PFAM
Pfam:SHIPPO-rpt 97 127 9.1e1 PFAM
Pfam:SHIPPO-rpt 162 193 1.3e2 PFAM
Pfam:SHIPPO-rpt 200 235 1.7e0 PFAM
Pfam:SHIPPO-rpt 249 285 1.2e-2 PFAM
Pfam:SHIPPO-rpt 292 315 3.2e1 PFAM
Pfam:SHIPPO-rpt 334 371 2.1e0 PFAM
Pfam:SHIPPO-rpt 421 462 3.8e0 PFAM
Pfam:SHIPPO-rpt 471 497 2.9e1 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106239
SMART Domains Protein: ENSMUSP00000101846
Gene: ENSMUSG00000047940

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 200 220 6.9e-1 PFAM
Pfam:SHIPPO-rpt 249 285 8.8e-2 PFAM
Pfam:SHIPPO-rpt 334 371 5.4e-2 PFAM
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Stpg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Stpg2 APN 3 139419874 splice site probably benign
IGL01505:Stpg2 APN 3 139317453 missense probably benign 0.02
IGL01649:Stpg2 APN 3 139419862 missense probably damaging 1.00
IGL03264:Stpg2 APN 3 139309209 missense possibly damaging 0.72
PIT4687001:Stpg2 UTSW 3 139215265 missense possibly damaging 0.89
R0053:Stpg2 UTSW 3 139212321 missense probably benign 0.00
R0099:Stpg2 UTSW 3 139243193 splice site probably benign
R0417:Stpg2 UTSW 3 139218321 missense probably damaging 1.00
R1646:Stpg2 UTSW 3 139419702 splice site probably benign
R1719:Stpg2 UTSW 3 139232199 missense probably benign 0.11
R1791:Stpg2 UTSW 3 139317401 missense probably benign 0.00
R1799:Stpg2 UTSW 3 139419781 missense probably damaging 1.00
R1912:Stpg2 UTSW 3 139522981 splice site probably null
R1974:Stpg2 UTSW 3 139309183 nonsense probably null
R3725:Stpg2 UTSW 3 139317477 missense probably benign 0.00
R3727:Stpg2 UTSW 3 139298496 missense probably damaging 1.00
R4225:Stpg2 UTSW 3 139215292 missense probably damaging 0.97
R4694:Stpg2 UTSW 3 139317416 missense possibly damaging 0.94
R4698:Stpg2 UTSW 3 139309229 missense probably damaging 1.00
R4879:Stpg2 UTSW 3 139215373 missense probably benign 0.03
R5236:Stpg2 UTSW 3 139232223 missense probably damaging 1.00
R5476:Stpg2 UTSW 3 139243138 missense probably benign 0.03
R5567:Stpg2 UTSW 3 139419786 missense probably benign 0.22
R6297:Stpg2 UTSW 3 139701671 missense possibly damaging 0.91
R6692:Stpg2 UTSW 3 139522977 critical splice donor site probably null
R7113:Stpg2 UTSW 3 139701774 critical splice donor site probably null
R7154:Stpg2 UTSW 3 139215295 missense probably benign 0.44
R7553:Stpg2 UTSW 3 139218337 missense probably damaging 1.00
R7660:Stpg2 UTSW 3 139701697 missense probably damaging 0.98
R8105:Stpg2 UTSW 3 139243164 missense probably damaging 1.00
R8154:Stpg2 UTSW 3 139309177 missense probably damaging 1.00
X0009:Stpg2 UTSW 3 139298462 missense probably benign 0.00
X0018:Stpg2 UTSW 3 139243090 missense probably benign 0.44
Z1176:Stpg2 UTSW 3 139701640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCACTCCTATAGGGTCTC -3'
(R):5'- TACATGTGTGCCTCTGGATC -3'

Sequencing Primer
(F):5'- CTCCTATAGGGTCTCATATTTAATAG -3'
(R):5'- GTGCCTCTGGATCTGGTTAAGAAAAC -3'
Posted On2019-12-04