Incidental Mutation 'RF021:Efhd2'
ID603874
Institutional Source Beutler Lab
Gene Symbol Efhd2
Ensembl Gene ENSMUSG00000040659
Gene NameEF hand domain containing 2
Synonymsswiprosin 1, D4Wsu27e, 2600015J22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #RF021 (G1)
Quality Score214.46
Status Not validated
Chromosome4
Chromosomal Location141858142-141874920 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCC to GCCGCCCCC at 141874773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036854]
Predicted Effect probably benign
Transcript: ENSMUST00000036854
SMART Domains Protein: ENSMUSP00000044502
Gene: ENSMUSG00000040659

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
EFh 96 124 1.44e-2 SMART
EFh 132 160 2.71e0 SMART
coiled coil region 199 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced germinal center responses and humoral type 2 immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Efhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Efhd2 APN 4 141859865 missense probably benign 0.05
IGL01710:Efhd2 APN 4 141860561 missense probably damaging 1.00
IGL01869:Efhd2 APN 4 141874602 missense probably damaging 1.00
FR4589:Efhd2 UTSW 4 141874764 small insertion probably benign
R0109:Efhd2 UTSW 4 141874567 missense probably benign 0.00
R0711:Efhd2 UTSW 4 141859872 missense probably damaging 1.00
R6861:Efhd2 UTSW 4 141859881 splice site probably null
R7765:Efhd2 UTSW 4 141874575 missense probably damaging 0.97
RF008:Efhd2 UTSW 4 141874758 small insertion probably benign
RF010:Efhd2 UTSW 4 141874764 small insertion probably benign
RF012:Efhd2 UTSW 4 141874768 small insertion probably benign
RF015:Efhd2 UTSW 4 141874756 small insertion probably benign
RF016:Efhd2 UTSW 4 141874756 small insertion probably benign
RF023:Efhd2 UTSW 4 141874762 small insertion probably benign
RF024:Efhd2 UTSW 4 141874762 small insertion probably benign
RF025:Efhd2 UTSW 4 141874771 small insertion probably benign
RF032:Efhd2 UTSW 4 141874772 small insertion probably benign
RF044:Efhd2 UTSW 4 141874768 small insertion probably benign
RF056:Efhd2 UTSW 4 141874767 small insertion probably benign
RF057:Efhd2 UTSW 4 141874769 small insertion probably benign
RF062:Efhd2 UTSW 4 141874755 small insertion probably benign
RF062:Efhd2 UTSW 4 141874774 small insertion probably benign
RF064:Efhd2 UTSW 4 141874755 small insertion probably benign
Z1177:Efhd2 UTSW 4 141874683 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGAACTCGGTGTAGGG -3'
(R):5'- TCACCCAGAGGTCATCAGAG -3'

Sequencing Primer
(F):5'- ACTCGGTGTAGGGGTTGAAGAC -3'
(R):5'- TAAGTCCCACCTTCAGGGC -3'
Posted On2019-12-04