Incidental Mutation 'RF021:Efhd2'
ID 603874
Institutional Source Beutler Lab
Gene Symbol Efhd2
Ensembl Gene ENSMUSG00000040659
Gene Name EF hand domain containing 2
Synonyms D4Wsu27e, 2600015J22Rik, swiprosin 1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # RF021 (G1)
Quality Score 214.46
Status Not validated
Chromosome 4
Chromosomal Location 141585453-141602231 bp(-) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCC to GCCGCCCCC at 141602084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036854]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036854
SMART Domains Protein: ENSMUSP00000044502
Gene: ENSMUSG00000040659

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
EFh 96 124 1.44e-2 SMART
EFh 132 160 2.71e0 SMART
coiled coil region 199 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced germinal center responses and humoral type 2 immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Efhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Efhd2 APN 4 141,587,176 (GRCm39) missense probably benign 0.05
IGL01710:Efhd2 APN 4 141,587,872 (GRCm39) missense probably damaging 1.00
IGL01869:Efhd2 APN 4 141,601,913 (GRCm39) missense probably damaging 1.00
FR4589:Efhd2 UTSW 4 141,602,075 (GRCm39) small insertion probably benign
R0109:Efhd2 UTSW 4 141,601,878 (GRCm39) missense probably benign 0.00
R0711:Efhd2 UTSW 4 141,587,183 (GRCm39) missense probably damaging 1.00
R6861:Efhd2 UTSW 4 141,587,192 (GRCm39) splice site probably null
R7765:Efhd2 UTSW 4 141,601,886 (GRCm39) missense probably damaging 0.97
R8275:Efhd2 UTSW 4 141,602,073 (GRCm39) missense probably benign 0.31
R8504:Efhd2 UTSW 4 141,587,186 (GRCm39) nonsense probably null
RF008:Efhd2 UTSW 4 141,602,069 (GRCm39) small insertion probably benign
RF010:Efhd2 UTSW 4 141,602,075 (GRCm39) small insertion probably benign
RF012:Efhd2 UTSW 4 141,602,079 (GRCm39) small insertion probably benign
RF015:Efhd2 UTSW 4 141,602,067 (GRCm39) small insertion probably benign
RF016:Efhd2 UTSW 4 141,602,067 (GRCm39) small insertion probably benign
RF023:Efhd2 UTSW 4 141,602,073 (GRCm39) small insertion probably benign
RF024:Efhd2 UTSW 4 141,602,073 (GRCm39) small insertion probably benign
RF025:Efhd2 UTSW 4 141,602,082 (GRCm39) small insertion probably benign
RF032:Efhd2 UTSW 4 141,602,083 (GRCm39) small insertion probably benign
RF044:Efhd2 UTSW 4 141,602,079 (GRCm39) small insertion probably benign
RF056:Efhd2 UTSW 4 141,602,078 (GRCm39) small insertion probably benign
RF057:Efhd2 UTSW 4 141,602,080 (GRCm39) small insertion probably benign
RF062:Efhd2 UTSW 4 141,602,085 (GRCm39) small insertion probably benign
RF062:Efhd2 UTSW 4 141,602,066 (GRCm39) small insertion probably benign
RF064:Efhd2 UTSW 4 141,602,066 (GRCm39) small insertion probably benign
Z1177:Efhd2 UTSW 4 141,601,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGAACTCGGTGTAGGG -3'
(R):5'- TCACCCAGAGGTCATCAGAG -3'

Sequencing Primer
(F):5'- ACTCGGTGTAGGGGTTGAAGAC -3'
(R):5'- TAAGTCCCACCTTCAGGGC -3'
Posted On 2019-12-04