Incidental Mutation 'RF021:Pramel16'
ID 603875
Institutional Source Beutler Lab
Gene Symbol Pramel16
Ensembl Gene ENSMUSG00000078511
Gene Name PRAME like 16
Synonyms Pramef25, Gm13109
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143675150-143677586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 143675478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 449 (Q449H)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
AlphaFold A2ASI9
Predicted Effect probably damaging
Transcript: ENSMUST00000105766
AA Change: Q449H

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: Q449H

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 427 2e-10 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Pramel16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramel16 APN 4 143,676,784 (GRCm39) splice site probably benign
IGL01562:Pramel16 APN 4 143,677,435 (GRCm39) missense probably damaging 1.00
IGL02422:Pramel16 APN 4 143,676,453 (GRCm39) missense probably benign 0.25
IGL02632:Pramel16 APN 4 143,676,507 (GRCm39) missense possibly damaging 0.84
IGL02745:Pramel16 APN 4 143,677,294 (GRCm39) missense probably damaging 1.00
IGL02808:Pramel16 APN 4 143,677,585 (GRCm39) utr 5 prime probably benign
IGL02883:Pramel16 APN 4 143,676,418 (GRCm39) missense possibly damaging 0.64
IGL02961:Pramel16 APN 4 143,675,717 (GRCm39) missense probably damaging 1.00
IGL03092:Pramel16 APN 4 143,676,767 (GRCm39) missense probably damaging 0.97
FR4340:Pramel16 UTSW 4 143,676,312 (GRCm39) missense probably damaging 0.99
FR4342:Pramel16 UTSW 4 143,676,327 (GRCm39) frame shift probably null
FR4342:Pramel16 UTSW 4 143,676,312 (GRCm39) missense probably damaging 0.99
R0533:Pramel16 UTSW 4 143,677,290 (GRCm39) missense possibly damaging 0.85
R0606:Pramel16 UTSW 4 143,676,453 (GRCm39) missense probably benign 0.25
R1624:Pramel16 UTSW 4 143,676,400 (GRCm39) missense possibly damaging 0.47
R1898:Pramel16 UTSW 4 143,677,298 (GRCm39) missense probably damaging 1.00
R2029:Pramel16 UTSW 4 143,676,453 (GRCm39) missense probably benign 0.25
R2867:Pramel16 UTSW 4 143,675,456 (GRCm39) missense probably benign 0.00
R2867:Pramel16 UTSW 4 143,675,456 (GRCm39) missense probably benign 0.00
R2894:Pramel16 UTSW 4 143,675,692 (GRCm39) missense probably damaging 1.00
R4111:Pramel16 UTSW 4 143,676,475 (GRCm39) missense possibly damaging 0.93
R4298:Pramel16 UTSW 4 143,675,713 (GRCm39) nonsense probably null
R4360:Pramel16 UTSW 4 143,677,433 (GRCm39) missense possibly damaging 0.81
R4361:Pramel16 UTSW 4 143,677,433 (GRCm39) missense possibly damaging 0.81
R5137:Pramel16 UTSW 4 143,675,690 (GRCm39) missense probably benign 0.08
R5195:Pramel16 UTSW 4 143,677,450 (GRCm39) missense probably damaging 0.99
R5312:Pramel16 UTSW 4 143,675,665 (GRCm39) missense possibly damaging 0.96
R5548:Pramel16 UTSW 4 143,676,550 (GRCm39) missense probably benign 0.24
R5591:Pramel16 UTSW 4 143,675,377 (GRCm39) missense probably damaging 1.00
R5644:Pramel16 UTSW 4 143,675,374 (GRCm39) missense probably benign 0.01
R6018:Pramel16 UTSW 4 143,677,469 (GRCm39) missense possibly damaging 0.61
R6177:Pramel16 UTSW 4 143,675,576 (GRCm39) missense possibly damaging 0.51
R6335:Pramel16 UTSW 4 143,675,602 (GRCm39) missense probably benign 0.02
R6376:Pramel16 UTSW 4 143,677,267 (GRCm39) missense probably benign 0.03
R6572:Pramel16 UTSW 4 143,676,262 (GRCm39) missense probably benign 0.01
R6845:Pramel16 UTSW 4 143,676,394 (GRCm39) missense probably benign
R6939:Pramel16 UTSW 4 143,675,366 (GRCm39) missense probably benign 0.09
R7081:Pramel16 UTSW 4 143,675,848 (GRCm39) missense probably damaging 1.00
R7505:Pramel16 UTSW 4 143,676,273 (GRCm39) missense possibly damaging 0.94
R7711:Pramel16 UTSW 4 143,675,822 (GRCm39) missense probably benign 0.22
R8284:Pramel16 UTSW 4 143,676,695 (GRCm39) missense possibly damaging 0.95
R8297:Pramel16 UTSW 4 143,675,690 (GRCm39) missense probably benign 0.08
R8299:Pramel16 UTSW 4 143,677,327 (GRCm39) missense probably benign 0.24
R8700:Pramel16 UTSW 4 143,675,701 (GRCm39) missense possibly damaging 0.51
R9179:Pramel16 UTSW 4 143,676,294 (GRCm39) missense probably benign 0.01
R9199:Pramel16 UTSW 4 143,675,656 (GRCm39) missense probably damaging 1.00
R9214:Pramel16 UTSW 4 143,675,750 (GRCm39) missense probably benign 0.00
R9411:Pramel16 UTSW 4 143,676,215 (GRCm39) missense probably damaging 1.00
RF011:Pramel16 UTSW 4 143,675,478 (GRCm39) missense probably damaging 0.96
RF013:Pramel16 UTSW 4 143,675,478 (GRCm39) missense probably damaging 0.96
Z1176:Pramel16 UTSW 4 143,676,693 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCAGGAACCCCTTGATCATAGAC -3'
(R):5'- ATCCCTGCCCTGAATAAGTGC -3'

Sequencing Primer
(F):5'- AGGAACCCCTTGATCATAGACTTGTC -3'
(R):5'- ATAAGTGCTCTCAGCTCATCGAGG -3'
Posted On 2019-12-04