Incidental Mutation 'RF021:Pramef25'
ID 603875
Institutional Source Beutler Lab
Gene Symbol Pramef25
Ensembl Gene ENSMUSG00000078511
Gene Name PRAME family member 25
Synonyms Gm13109
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143948580-143951016 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 143948908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 449 (Q449H)
Ref Sequence ENSEMBL: ENSMUSP00000101392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105766]
AlphaFold A2ASI9
Predicted Effect probably damaging
Transcript: ENSMUST00000105766
AA Change: Q449H

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101392
Gene: ENSMUSG00000078511
AA Change: Q449H

SCOP:d1a4ya_ 223 427 2e-10 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Pramef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Pramef25 APN 4 143950214 splice site probably benign
IGL01562:Pramef25 APN 4 143950865 missense probably damaging 1.00
IGL02422:Pramef25 APN 4 143949883 missense probably benign 0.25
IGL02632:Pramef25 APN 4 143949937 missense possibly damaging 0.84
IGL02745:Pramef25 APN 4 143950724 missense probably damaging 1.00
IGL02808:Pramef25 APN 4 143951015 utr 5 prime probably benign
IGL02883:Pramef25 APN 4 143949848 missense possibly damaging 0.64
IGL02961:Pramef25 APN 4 143949147 missense probably damaging 1.00
IGL03092:Pramef25 APN 4 143950197 missense probably damaging 0.97
FR4340:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949742 missense probably damaging 0.99
FR4342:Pramef25 UTSW 4 143949757 frame shift probably null
R0533:Pramef25 UTSW 4 143950720 missense possibly damaging 0.85
R0606:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R1624:Pramef25 UTSW 4 143949830 missense possibly damaging 0.47
R1898:Pramef25 UTSW 4 143950728 missense probably damaging 1.00
R2029:Pramef25 UTSW 4 143949883 missense probably benign 0.25
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2867:Pramef25 UTSW 4 143948886 missense probably benign 0.00
R2894:Pramef25 UTSW 4 143949122 missense probably damaging 1.00
R4111:Pramef25 UTSW 4 143949905 missense possibly damaging 0.93
R4298:Pramef25 UTSW 4 143949143 nonsense probably null
R4360:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R4361:Pramef25 UTSW 4 143950863 missense possibly damaging 0.81
R5137:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R5195:Pramef25 UTSW 4 143950880 missense probably damaging 0.99
R5312:Pramef25 UTSW 4 143949095 missense possibly damaging 0.96
R5548:Pramef25 UTSW 4 143949980 missense probably benign 0.24
R5591:Pramef25 UTSW 4 143948807 missense probably damaging 1.00
R5644:Pramef25 UTSW 4 143948804 missense probably benign 0.01
R6018:Pramef25 UTSW 4 143950899 missense possibly damaging 0.61
R6177:Pramef25 UTSW 4 143949006 missense possibly damaging 0.51
R6335:Pramef25 UTSW 4 143949032 missense probably benign 0.02
R6376:Pramef25 UTSW 4 143950697 missense probably benign 0.03
R6572:Pramef25 UTSW 4 143949692 missense probably benign 0.01
R6845:Pramef25 UTSW 4 143949824 missense probably benign
R6939:Pramef25 UTSW 4 143948796 missense probably benign 0.09
R7081:Pramef25 UTSW 4 143949278 missense probably damaging 1.00
R7505:Pramef25 UTSW 4 143949703 missense possibly damaging 0.94
R7711:Pramef25 UTSW 4 143949252 missense probably benign 0.22
R8284:Pramef25 UTSW 4 143950125 missense possibly damaging 0.95
R8297:Pramef25 UTSW 4 143949120 missense probably benign 0.08
R8299:Pramef25 UTSW 4 143950757 missense probably benign 0.24
R8700:Pramef25 UTSW 4 143949131 missense possibly damaging 0.51
R9179:Pramef25 UTSW 4 143949724 missense probably benign 0.01
R9199:Pramef25 UTSW 4 143949086 missense probably damaging 1.00
R9214:Pramef25 UTSW 4 143949180 missense probably benign 0.00
R9411:Pramef25 UTSW 4 143949645 missense probably damaging 1.00
RF011:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
RF013:Pramef25 UTSW 4 143948908 missense probably damaging 0.96
Z1176:Pramef25 UTSW 4 143950123 missense probably benign 0.13
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04