Incidental Mutation 'RF021:Gtf2h1'
ID 603882
Institutional Source Beutler Lab
Gene Symbol Gtf2h1
Ensembl Gene ENSMUSG00000006599
Gene Name general transcription factor II H, polypeptide 1
Synonyms p62, 62kDa
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 46445527-46473224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46453289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 74 (V74G)
Ref Sequence ENSEMBL: ENSMUSP00000103271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006774] [ENSMUST00000107644] [ENSMUST00000128420] [ENSMUST00000165031]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000006774
AA Change: V68G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006774
Gene: ENSMUSG00000006599
AA Change: V68G

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 9 81 6.8e-25 PFAM
BSD 99 154 8.89e-11 SMART
BSD 179 231 2.09e-16 SMART
low complexity region 417 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107644
AA Change: V74G

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103271
Gene: ENSMUSG00000006599
AA Change: V74G

DomainStartEndE-ValueType
Pfam:PH_TFIIH 22 103 8.5e-29 PFAM
BSD 105 160 8.89e-11 SMART
BSD 185 237 2.09e-16 SMART
low complexity region 423 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128420
SMART Domains Protein: ENSMUSP00000120008
Gene: ENSMUSG00000006599

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 9 51 1.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165031
AA Change: V74G

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129337
Gene: ENSMUSG00000006599
AA Change: V74G

DomainStartEndE-ValueType
Pfam:TFIIH_BTF_p62_N 15 87 5.5e-26 PFAM
Pfam:BSD 104 144 8.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Gtf2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Gtf2h1 APN 7 46,468,634 (GRCm39) missense possibly damaging 0.90
IGL01108:Gtf2h1 APN 7 46,461,922 (GRCm39) missense probably damaging 1.00
IGL02054:Gtf2h1 APN 7 46,464,849 (GRCm39) splice site probably benign
IGL02075:Gtf2h1 APN 7 46,451,165 (GRCm39) missense probably damaging 1.00
IGL02309:Gtf2h1 APN 7 46,465,812 (GRCm39) missense probably damaging 0.99
IGL02423:Gtf2h1 APN 7 46,464,824 (GRCm39) missense probably benign
IGL02481:Gtf2h1 APN 7 46,454,417 (GRCm39) missense probably damaging 1.00
IGL03159:Gtf2h1 APN 7 46,456,167 (GRCm39) missense possibly damaging 0.80
R0136:Gtf2h1 UTSW 7 46,464,840 (GRCm39) missense possibly damaging 0.49
R1073:Gtf2h1 UTSW 7 46,466,368 (GRCm39) missense probably damaging 1.00
R1242:Gtf2h1 UTSW 7 46,462,175 (GRCm39) critical splice donor site probably null
R1469:Gtf2h1 UTSW 7 46,454,549 (GRCm39) critical splice donor site probably null
R1469:Gtf2h1 UTSW 7 46,454,549 (GRCm39) critical splice donor site probably null
R1740:Gtf2h1 UTSW 7 46,461,890 (GRCm39) missense probably null
R2192:Gtf2h1 UTSW 7 46,464,747 (GRCm39) missense possibly damaging 0.73
R3012:Gtf2h1 UTSW 7 46,453,319 (GRCm39) missense probably damaging 1.00
R4238:Gtf2h1 UTSW 7 46,454,489 (GRCm39) missense probably benign
R4239:Gtf2h1 UTSW 7 46,454,489 (GRCm39) missense probably benign
R4715:Gtf2h1 UTSW 7 46,464,836 (GRCm39) missense possibly damaging 0.66
R4776:Gtf2h1 UTSW 7 46,472,302 (GRCm39) nonsense probably null
R6193:Gtf2h1 UTSW 7 46,456,254 (GRCm39) critical splice donor site probably null
R6338:Gtf2h1 UTSW 7 46,465,880 (GRCm39) missense probably benign
R6556:Gtf2h1 UTSW 7 46,458,089 (GRCm39) missense probably damaging 1.00
R7102:Gtf2h1 UTSW 7 46,468,550 (GRCm39) missense probably benign 0.21
R8232:Gtf2h1 UTSW 7 46,451,103 (GRCm39) missense probably benign 0.02
R8273:Gtf2h1 UTSW 7 46,454,474 (GRCm39) missense probably benign 0.00
R8414:Gtf2h1 UTSW 7 46,464,768 (GRCm39) missense possibly damaging 0.83
R9006:Gtf2h1 UTSW 7 46,458,262 (GRCm39) missense probably benign 0.00
R9545:Gtf2h1 UTSW 7 46,458,112 (GRCm39) critical splice donor site probably null
R9602:Gtf2h1 UTSW 7 46,456,219 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CGGTGCCATGCGTGTATATG -3'
(R):5'- ATGGCAATGACAGCACAGATC -3'

Sequencing Primer
(F):5'- CTCCAGGATTCCAGGTTAGGCTTAAG -3'
(R):5'- AGATCCCCACTCTCACCTG -3'
Posted On 2019-12-04