Incidental Mutation 'RF021:Olfr229'
ID603886
Institutional Source Beutler Lab
Gene Symbol Olfr229
Ensembl Gene ENSMUSG00000095390
Gene Nameolfactory receptor 229
SynonymsGA_x6K02T02EEW-227-373, MOR171-14, Olfr973, GA_x6K02T2PVTD-33608180-33608971
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39907336-39912732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39910045 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 81 (M81L)
Ref Sequence ENSEMBL: ENSMUSP00000149063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076802] [ENSMUST00000214904]
Predicted Effect probably benign
Transcript: ENSMUST00000076802
AA Change: M81L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076080
Gene: ENSMUSG00000095390
AA Change: M81L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.7e-51 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214904
AA Change: M81L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Olfr229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr229 APN 9 39910606 missense possibly damaging 0.94
IGL01880:Olfr229 APN 9 39909941 missense possibly damaging 0.95
IGL02142:Olfr229 APN 9 39910639 missense possibly damaging 0.75
IGL02366:Olfr229 APN 9 39909992 missense probably damaging 1.00
R0415:Olfr229 UTSW 9 39909983 missense probably damaging 1.00
R1383:Olfr229 UTSW 9 39909864 missense probably benign 0.10
R1838:Olfr229 UTSW 9 39909841 missense possibly damaging 0.90
R3196:Olfr229 UTSW 9 39910460 missense probably damaging 0.99
R3951:Olfr229 UTSW 9 39910725 missense probably benign 0.40
R4984:Olfr229 UTSW 9 39910610 missense probably benign 0.14
R5771:Olfr229 UTSW 9 39910250 missense probably damaging 1.00
R7454:Olfr229 UTSW 9 39909904 missense probably benign 0.02
R7756:Olfr229 UTSW 9 39910325 missense possibly damaging 0.95
R7758:Olfr229 UTSW 9 39910325 missense possibly damaging 0.95
R7868:Olfr229 UTSW 9 39909986 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTGGATTCTCAACCAAACCAG -3'
(R):5'- TGTAAACTCCCACGGTGAGC -3'

Sequencing Primer
(F):5'- GGATTCTCAACCAAACCAGAGCTG -3'
(R):5'- TCCCACGGTGAGCCAGAAG -3'
Posted On2019-12-04