Incidental Mutation 'RF021:Or8g2'
ID 603886
Institutional Source Beutler Lab
Gene Symbol Or8g2
Ensembl Gene ENSMUSG00000095390
Gene Name olfactory receptor family 8 subfamily G member 2
Synonyms Olfr229, Olfr973, GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, MOR171-14
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39821101-39822024 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39821341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 81 (M81L)
Ref Sequence ENSEMBL: ENSMUSP00000149063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076802] [ENSMUST00000214904]
AlphaFold Q8VFN5
Predicted Effect probably benign
Transcript: ENSMUST00000076802
AA Change: M81L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076080
Gene: ENSMUSG00000095390
AA Change: M81L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.7e-51 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214904
AA Change: M81L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Or8g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Or8g2 APN 9 39,821,902 (GRCm39) missense possibly damaging 0.94
IGL01880:Or8g2 APN 9 39,821,237 (GRCm39) missense possibly damaging 0.95
IGL02142:Or8g2 APN 9 39,821,935 (GRCm39) missense possibly damaging 0.75
IGL02366:Or8g2 APN 9 39,821,288 (GRCm39) missense probably damaging 1.00
R0415:Or8g2 UTSW 9 39,821,279 (GRCm39) missense probably damaging 1.00
R1383:Or8g2 UTSW 9 39,821,160 (GRCm39) missense probably benign 0.10
R1838:Or8g2 UTSW 9 39,821,137 (GRCm39) missense possibly damaging 0.90
R3196:Or8g2 UTSW 9 39,821,756 (GRCm39) missense probably damaging 0.99
R3951:Or8g2 UTSW 9 39,822,021 (GRCm39) missense probably benign 0.40
R4984:Or8g2 UTSW 9 39,821,906 (GRCm39) missense probably benign 0.14
R5771:Or8g2 UTSW 9 39,821,546 (GRCm39) missense probably damaging 1.00
R7454:Or8g2 UTSW 9 39,821,200 (GRCm39) missense probably benign 0.02
R7756:Or8g2 UTSW 9 39,821,621 (GRCm39) missense possibly damaging 0.95
R7758:Or8g2 UTSW 9 39,821,621 (GRCm39) missense possibly damaging 0.95
R7868:Or8g2 UTSW 9 39,821,282 (GRCm39) missense probably benign
R8670:Or8g2 UTSW 9 39,821,719 (GRCm39) missense probably benign 0.02
R8963:Or8g2 UTSW 9 39,821,495 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGGATTCTCAACCAAACCAG -3'
(R):5'- TGTAAACTCCCACGGTGAGC -3'

Sequencing Primer
(F):5'- GGATTCTCAACCAAACCAGAGCTG -3'
(R):5'- TCCCACGGTGAGCCAGAAG -3'
Posted On 2019-12-04