Incidental Mutation 'RF021:Ngp'
Institutional Source Beutler Lab
Gene Symbol Ngp
Ensembl Gene ENSMUSG00000032484
Gene Nameneutrophilic granule protein
Synonymsmyeloid granule protein, bectenecin, clone B6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosomal Location110419747-110423012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110421756 bp
Amino Acid Change Threonine to Alanine at position 114 (T114A)
Ref Sequence ENSEMBL: ENSMUSP00000035061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035061] [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035061
AA Change: T114A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035061
Gene: ENSMUSG00000032484
AA Change: T114A

CY 10 116 7.92e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068025
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792

BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect probably benign
Transcript: ENSMUST00000198164
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792

BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198400
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792

Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Ngp
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Ngp UTSW 9 110422269 unclassified probably benign
R0230:Ngp UTSW 9 110420001 missense probably damaging 1.00
R2004:Ngp UTSW 9 110420861 missense probably damaging 1.00
R4610:Ngp UTSW 9 110420815 missense possibly damaging 0.92
R5100:Ngp UTSW 9 110420001 missense probably damaging 1.00
R5762:Ngp UTSW 9 110422333 missense probably benign 0.09
R6514:Ngp UTSW 9 110419949 missense probably damaging 0.98
R6791:Ngp UTSW 9 110419949 missense probably benign 0.01
R7286:Ngp UTSW 9 110420910 missense probably benign 0.00
R7500:Ngp UTSW 9 110419765 splice site probably null
R7820:Ngp UTSW 9 110420864 missense probably benign 0.04
R8119:Ngp UTSW 9 110422353 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04