Incidental Mutation 'RF021:Ngp'
ID 603888
Institutional Source Beutler Lab
Gene Symbol Ngp
Ensembl Gene ENSMUSG00000032484
Gene Name neutrophilic granule protein
Synonyms myeloid granule protein, bectenecin, clone B6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 110419747-110423012 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110421756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 114 (T114A)
Ref Sequence ENSEMBL: ENSMUSP00000035061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035061] [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
AlphaFold O08692
Predicted Effect possibly damaging
Transcript: ENSMUST00000035061
AA Change: T114A

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000035061
Gene: ENSMUSG00000032484
AA Change: T114A

CY 10 116 7.92e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068025
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792

BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect probably benign
Transcript: ENSMUST00000198164
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792

BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198400
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792

Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Ngp
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Ngp UTSW 9 110422269 unclassified probably benign
R0230:Ngp UTSW 9 110420001 missense probably damaging 1.00
R2004:Ngp UTSW 9 110420861 missense probably damaging 1.00
R4610:Ngp UTSW 9 110420815 missense possibly damaging 0.92
R5100:Ngp UTSW 9 110420001 missense probably damaging 1.00
R5762:Ngp UTSW 9 110422333 missense probably benign 0.09
R6514:Ngp UTSW 9 110419949 missense probably damaging 0.98
R6791:Ngp UTSW 9 110419949 missense probably benign 0.01
R7286:Ngp UTSW 9 110420910 missense probably benign 0.00
R7500:Ngp UTSW 9 110419765 splice site probably null
R7820:Ngp UTSW 9 110420864 missense probably benign 0.04
R8119:Ngp UTSW 9 110422353 missense probably benign 0.00
R9025:Ngp UTSW 9 110422383 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04