Incidental Mutation 'RF021:Lrrc2'
ID603889
Institutional Source Beutler Lab
Gene Symbol Lrrc2
Ensembl Gene ENSMUSG00000032495
Gene Nameleucine rich repeat containing 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF021 (G1)
Quality Score214.458
Status Validated
Chromosome9
Chromosomal Location110951545-110984066 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) TTGATTCGGTTCACC to T at 110981676 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000084922] [ENSMUST00000199891]
Predicted Effect probably null
Transcript: ENSMUST00000035076
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084922
SMART Domains Protein: ENSMUSP00000081985
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196598
Predicted Effect probably benign
Transcript: ENSMUST00000199891
SMART Domains Protein: ENSMUSP00000143305
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing family of proteins, which function in diverse biological pathways. This family member may possibly be a nuclear protein. Similarity to the RAS suppressor protein, as well as expression down-regulation observed in tumor cells, suggests that it may function as a tumor suppressor. The gene is located in the chromosome 3 common eliminated region 1 (C3CER1), a 1.4 Mb region that is commonly deleted in diverse tumors. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Lrrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Lrrc2 APN 9 110980818 unclassified probably null
IGL02243:Lrrc2 APN 9 110970057 missense probably damaging 1.00
IGL02715:Lrrc2 APN 9 110970114 missense probably damaging 1.00
IGL02793:Lrrc2 APN 9 110979627 critical splice donor site probably null
IGL02958:Lrrc2 APN 9 110962673 critical splice donor site probably null
PIT4362001:Lrrc2 UTSW 9 110962540 missense possibly damaging 0.91
R0255:Lrrc2 UTSW 9 110980898 missense possibly damaging 0.87
R0472:Lrrc2 UTSW 9 110962617 missense probably benign 0.00
R0909:Lrrc2 UTSW 9 110962673 critical splice donor site probably null
R1575:Lrrc2 UTSW 9 110979487 missense probably benign 0.07
R1619:Lrrc2 UTSW 9 110960973 missense probably benign 0.00
R1669:Lrrc2 UTSW 9 110981650 missense probably damaging 0.99
R1778:Lrrc2 UTSW 9 110980840 missense probably benign
R1914:Lrrc2 UTSW 9 110980939 missense probably damaging 1.00
R2165:Lrrc2 UTSW 9 110979577 missense possibly damaging 0.78
R3792:Lrrc2 UTSW 9 110966517 nonsense probably null
R3793:Lrrc2 UTSW 9 110966517 nonsense probably null
R4499:Lrrc2 UTSW 9 110962645 missense probably benign 0.11
R4683:Lrrc2 UTSW 9 110962546 missense possibly damaging 0.95
R4693:Lrrc2 UTSW 9 110970093 missense probably damaging 1.00
R4723:Lrrc2 UTSW 9 110970160 critical splice donor site probably null
R5033:Lrrc2 UTSW 9 110980919 missense probably damaging 0.98
R5935:Lrrc2 UTSW 9 110966561 missense probably benign 0.17
R6269:Lrrc2 UTSW 9 110980949 missense probably damaging 1.00
R6645:Lrrc2 UTSW 9 110970107 missense probably damaging 1.00
R6855:Lrrc2 UTSW 9 110953182 intron probably null
R7621:Lrrc2 UTSW 9 110980831 missense probably benign 0.00
R7748:Lrrc2 UTSW 9 110980931 missense possibly damaging 0.63
R7827:Lrrc2 UTSW 9 110960981 missense possibly damaging 0.93
R8169:Lrrc2 UTSW 9 110980886 missense probably benign
R8186:Lrrc2 UTSW 9 110960842 missense possibly damaging 0.67
RF009:Lrrc2 UTSW 9 110981676 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATTATTTGTGGCTATTTGTGAACCA -3'
(R):5'- GTGCATTCGTCTGCTAACATTAA -3'

Sequencing Primer
(F):5'- TTGATCCCAGCATTCAGGAG -3'
(R):5'- GACTTTGTCCTTAAGCACAAG -3'
Posted On2019-12-04