Mutagenetix > Incidental Mutations

Incidental Mutation 'RF021:Lats1'

603890

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.835) question?

Stock #

RF021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7710608 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 912 (T912A)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: T912A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: T912A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: T912A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: T912A

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: T912A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.3%

Validation Efficiency

91% (50/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	TTATTATTATTAT	TTATTATTATTATTAATATTATTATTAT	3: 37,050,748		probably benign	Het
A030005L19Rik	GTGGTGGCTG	GTGGTGGCTGTGGTGGCTG	1: 82,913,569		probably benign	Het
AI837181	CGG	CGGTGG	19: 5,425,234		probably benign	Het
Ankrd44	T	C	1: 54,778,312	H79R	probably damaging	Het
Atg9a	T	A	1: 75,182,629	E826V	probably damaging	Het
Atrnl1	T	C	19: 57,642,473	V224A	probably benign	Het
Cpn2	G	A	16: 30,259,338	A515V	probably benign	Het
Cyp2a12	T	C	7: 27,035,360	F402S	possibly damaging	Het
Defb22	TGCGGCA	TGCGGCAGAGCTGGGCGTTGCGGCA	2: 152,485,832		probably benign	Het
Diexf	A	G	1: 193,120,666	F248L	probably benign	Het
Dnah10	G	T	5: 124,777,907	V2016F	probably damaging	Het
Dock10	T	C	1: 80,564,573		probably null	Het
Efhd2	GCC	GCCGCCCCC	4: 141,874,773		probably benign	Het
Fam131a	A	C	16: 20,694,940		probably benign	Het
Gm6614	A	T	6: 142,008,714	V31E	probably damaging	Het
Gm7247	AGACCAGACC	A	14: 51,364,324		probably benign	Het
Gna13	T	C	11: 109,392,392	V186A	probably benign	Het
Grk3	T	A	5: 112,941,688	I333L	probably benign	Het
Gstp1	A	T	19: 4,035,507	V200E	probably benign	Het
Gtf2h1	T	G	7: 46,803,865	V74G	possibly damaging	Het
Kcnh8	G	A	17: 52,978,239	R1079H	probably benign	Het
Kiz	A	G	2: 146,870,830	D138G	possibly damaging	Het
Kmt2b	TTCTCCT	TTCTCCTTCTCCT	7: 30,586,357		probably benign	Het
Lce1m	GCTGCCACC	GCTGCCACCACTTCTGCCACC	3: 93,018,269		probably benign	Het
Lce1m	TGCC	TGCCGCCGCTGCCGCC	3: 93,018,295		probably benign	Het
Lrrc2	TTGATTCGGTTCACC	T	9: 110,981,676		probably null	Het
Med12l	T	C	3: 59,073,290	F359S	probably benign	Het
Mut	A	G	17: 40,951,758	I444V	probably benign	Het
Ncoa2	CTTAAAA	C	1: 13,149,109		probably benign	Het
Ngp	A	G	9: 110,421,756	T114A	possibly damaging	Het
Nlrc5	A	T	8: 94,476,888	T539S	probably benign	Het
Nxf1	A	G	19: 8,772,309	D190G	probably damaging	Het
Olfr229	A	T	9: 39,910,045	M81L	probably benign	Het
Olfr769	A	T	10: 129,112,342	F28I	probably damaging	Het
Pramef25	C	G	4: 143,948,908	Q449H	probably damaging	Het
Prdm15	G	A	16: 97,808,756	H563Y	probably damaging	Het
Rbm12	CAGG	CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG	2: 156,096,106		probably benign	Het
Sema3g	C	T	14: 31,227,841	H660Y	probably damaging	Het
Smarca2	AGCAGCAGCAGCAGCAGCAGCA	AGCAGCAGCAGCAGCAGCAGCAGCAGCA	19: 26,630,997		probably benign	Het
Stpg2	A	T	3: 139,212,250		probably null	Het
Taar7f	C	T	10: 24,050,423	T305M	possibly damaging	Het
Tbcb	C	T	7: 30,224,346	V208M	probably damaging	Het
Tenm2	T	A	11: 36,024,203	Q2169L	possibly damaging	Het
Tln1	A	G	4: 43,555,890	V108A	probably damaging	Het
Tmc8	T	C	11: 117,783,234	M42T	probably benign	Het
Trdc	T	C	14: 54,144,203	V115A		Het
Ttbk2	A	G	2: 120,748,634	V669A	probably benign	Het
Tusc1	GCC	GCCACCACC	4: 93,335,316		probably benign	Het
Vps16	A	G	2: 130,438,209	H118R	probably benign	Het
Wdpcp	T	A	11: 21,711,587	C286*	probably null	Het
Zbed4	C	A	15: 88,781,236	Y502*	probably null	Het
Zdbf2	T	A	1: 63,302,652	N63K	possibly damaging	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGTGACCAGGGCTTATCAG -3'
(R):5'- GAGGTTGTCCCACCAACATTTC -3'

Sequencing Primer
(F):5'- CAGGGCTTATCAGGCTTGG -3'
(R):5'- CAGCTGTGTATATCCTAAAGGTACC -3'

Posted On

2019-12-04