Incidental Mutation 'RF021:Wdpcp'
ID 603893
Institutional Source Beutler Lab
Gene Symbol Wdpcp
Ensembl Gene ENSMUSG00000020319
Gene Name WD repeat containing planar cell polarity effector
Synonyms homoloc-13, AV249152
Accession Numbers
Essential gene? Probably essential (E-score: 0.932) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 21521969-21848686 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 21661587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 286 (C286*)
Ref Sequence ENSEMBL: ENSMUSP00000020568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020568]
AlphaFold Q8C456
Predicted Effect probably null
Transcript: ENSMUST00000020568
AA Change: C286*
SMART Domains Protein: ENSMUSP00000020568
Gene: ENSMUSG00000020319
AA Change: C286*

DomainStartEndE-ValueType
Pfam:DUF3312 48 591 4.4e-278 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic WD40 repeat protein. A similar gene in frogs encodes a planar cell polarity protein that plays a critical role in collective cell movement and ciliogenesis by mediating septin localization. Mutations in this gene are associated with Bardet-Biedl syndrome 15 and may also play a role in Meckel-Gruber syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a null mutation display ciliogenesis defects, anophthalmia, cysts in multiple tissues, central polydactyly, duplex kidney, and septation defects in the outflow tract and cloaca. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Wdpcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Wdpcp APN 11 21,609,995 (GRCm39) missense probably damaging 1.00
IGL01322:Wdpcp APN 11 21,661,949 (GRCm39) missense probably damaging 1.00
IGL01876:Wdpcp APN 11 21,763,383 (GRCm39) missense possibly damaging 0.92
IGL01879:Wdpcp APN 11 21,661,630 (GRCm39) missense probably damaging 0.99
IGL01913:Wdpcp APN 11 21,698,931 (GRCm39) missense probably damaging 1.00
IGL02127:Wdpcp APN 11 21,661,958 (GRCm39) missense possibly damaging 0.71
IGL03326:Wdpcp APN 11 21,835,048 (GRCm39) missense probably benign 0.05
R0040:Wdpcp UTSW 11 21,661,638 (GRCm39) missense probably damaging 1.00
R0040:Wdpcp UTSW 11 21,661,638 (GRCm39) missense probably damaging 1.00
R0142:Wdpcp UTSW 11 21,807,444 (GRCm39) splice site probably null
R2159:Wdpcp UTSW 11 21,807,476 (GRCm39) missense probably benign 0.01
R2163:Wdpcp UTSW 11 21,835,015 (GRCm39) nonsense probably null
R2165:Wdpcp UTSW 11 21,641,884 (GRCm39) missense probably damaging 1.00
R4239:Wdpcp UTSW 11 21,645,271 (GRCm39) missense probably benign 0.35
R4239:Wdpcp UTSW 11 21,645,269 (GRCm39) missense probably damaging 1.00
R4636:Wdpcp UTSW 11 21,661,568 (GRCm39) missense probably benign 0.03
R5558:Wdpcp UTSW 11 21,661,732 (GRCm39) missense probably benign 0.00
R6493:Wdpcp UTSW 11 21,661,631 (GRCm39) missense possibly damaging 0.83
R6678:Wdpcp UTSW 11 21,671,105 (GRCm39) missense probably benign
R6762:Wdpcp UTSW 11 21,671,244 (GRCm39) missense probably benign 0.11
R6957:Wdpcp UTSW 11 21,671,154 (GRCm39) missense possibly damaging 0.94
R7380:Wdpcp UTSW 11 21,661,585 (GRCm39) missense possibly damaging 0.52
R7458:Wdpcp UTSW 11 21,698,919 (GRCm39) missense probably damaging 0.97
R7876:Wdpcp UTSW 11 21,661,486 (GRCm39) missense probably benign 0.02
R8351:Wdpcp UTSW 11 21,698,931 (GRCm39) missense probably damaging 1.00
R8503:Wdpcp UTSW 11 21,671,205 (GRCm39) nonsense probably null
R8670:Wdpcp UTSW 11 21,645,196 (GRCm39) missense probably benign 0.00
R8710:Wdpcp UTSW 11 21,610,924 (GRCm39) missense probably benign 0.12
R9072:Wdpcp UTSW 11 21,614,014 (GRCm39) missense probably benign 0.07
R9188:Wdpcp UTSW 11 21,610,025 (GRCm39) missense probably damaging 1.00
R9242:Wdpcp UTSW 11 21,835,040 (GRCm39) missense probably benign
R9332:Wdpcp UTSW 11 21,661,522 (GRCm39) missense probably benign 0.15
R9673:Wdpcp UTSW 11 21,671,285 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAACCTGTCCTGTGCTTGAC -3'
(R):5'- TATCAATGAAGGCCTAAGTTCAGC -3'

Sequencing Primer
(F):5'- CTGTGCTTGACAGCTGAAGC -3'
(R):5'- AAGGCCTAAGTTCAGCCTGGG -3'
Posted On 2019-12-04