Incidental Mutation 'RF021:Gna13'
ID603895
Institutional Source Beutler Lab
Gene Symbol Gna13
Ensembl Gene ENSMUSG00000020611
Gene Nameguanine nucleotide binding protein, alpha 13
SynonymsGalpha13
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location109362831-109401369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109392392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 186 (V186A)
Ref Sequence ENSEMBL: ENSMUSP00000020930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020930]
PDB Structure
Crystal Structure of the p115RhoGEF rgRGS Domain in A Complex with Galpha(13):Galpha(i1) Chimera [X-RAY DIFFRACTION]
Crystal structure of G alpha 13 in complex with GDP [X-RAY DIFFRACTION]
Crystal structure of p115RhoGEF RGS domain in complex with G alpha 13 [X-RAY DIFFRACTION]
Crystal Structure of PDZRhoGEF rgRGS Domain in a Complex with Galpha-13 Bound to GDP [X-RAY DIFFRACTION]
Crystal Structure of PDZRhoGEF rgRGS Domain in a Complex with Galpha-13 Bound to GDP-AlF4 [X-RAY DIFFRACTION]
Crystal Structure of PDZRhoGEF rgRGS Domain in a Complex with Galpha-13 Bound to GTP-gamma-S [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020930
AA Change: V186A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020930
Gene: ENSMUSG00000020611
AA Change: V186A

DomainStartEndE-ValueType
G_alpha 28 376 5.28e-193 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null or with an endothelial specific conditional mutation fail to develop an organized vascular system in the yolk sac, show impaired vascular development in some vascular beds in the embryo proper, and die during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Gna13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Gna13 APN 11 109365743 missense probably damaging 1.00
R2844:Gna13 UTSW 11 109363125 missense probably damaging 1.00
R4009:Gna13 UTSW 11 109396017 missense probably damaging 1.00
R4094:Gna13 UTSW 11 109396416 missense probably damaging 1.00
R4793:Gna13 UTSW 11 109363629 intron probably benign
R6525:Gna13 UTSW 11 109395939 missense probably damaging 1.00
R6867:Gna13 UTSW 11 109396122 missense possibly damaging 0.84
R8243:Gna13 UTSW 11 109396413 missense probably damaging 1.00
Z1177:Gna13 UTSW 11 109396202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCCCCGTTAGTAGTTCTTTAAAG -3'
(R):5'- GAGGACAACTCAAGCCACTG -3'

Sequencing Primer
(F):5'- GAAAGAGGTCTCCCTATGTAGCC -3'
(R):5'- CCACTGGCACTGAAAGAAAAAG -3'
Posted On2019-12-04