Incidental Mutation 'RF021:Tmc8'
ID 603896
Institutional Source Beutler Lab
Gene Symbol Tmc8
Ensembl Gene ENSMUSG00000050106
Gene Name transmembrane channel-like gene family 8
Synonyms Ever2, EVIN2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # RF021 (G1)
Quality Score 191.009
Status Validated
Chromosome 11
Chromosomal Location 117782076-117793110 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117783234 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 42 (M42T)
Ref Sequence ENSEMBL: ENSMUSP00000101941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000050874] [ENSMUST00000103025] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455] [ENSMUST00000127080] [ENSMUST00000127227] [ENSMUST00000131606] [ENSMUST00000136729] [ENSMUST00000143406] [ENSMUST00000152304]
AlphaFold Q7TN58
Predicted Effect probably benign
Transcript: ENSMUST00000026659
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572

low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050874
AA Change: M42T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106
AA Change: M42T

transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103025
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572

low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106334
AA Change: M42T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106
AA Change: M42T

transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117781
AA Change: M42T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106
AA Change: M42T

transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119455
AA Change: M42T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106
AA Change: M42T

transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127080
AA Change: M42T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115270
Gene: ENSMUSG00000050106
AA Change: M42T

transmembrane domain 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127227
Predicted Effect probably benign
Transcript: ENSMUST00000131606
SMART Domains Protein: ENSMUSP00000123264
Gene: ENSMUSG00000025572

low complexity region 58 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136729
SMART Domains Protein: ENSMUSP00000118068
Gene: ENSMUSG00000025572

low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143406
SMART Domains Protein: ENSMUSP00000117566
Gene: ENSMUSG00000025572

low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
low complexity region 210 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152304
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Tmc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Tmc8 APN 11 117786504 missense probably damaging 1.00
IGL01098:Tmc8 APN 11 117792563 missense possibly damaging 0.47
IGL01403:Tmc8 APN 11 117791074 missense possibly damaging 0.94
IGL01526:Tmc8 APN 11 117792084 splice site probably benign
IGL02045:Tmc8 APN 11 117786520 missense probably damaging 1.00
IGL02138:Tmc8 APN 11 117791255 missense probably benign 0.01
IGL02581:Tmc8 APN 11 117783888 missense probably benign 0.01
IGL02685:Tmc8 APN 11 117792574 missense probably damaging 0.96
R0241:Tmc8 UTSW 11 117786381 unclassified probably benign
R0485:Tmc8 UTSW 11 117792078 splice site probably benign
R1168:Tmc8 UTSW 11 117792563 missense possibly damaging 0.47
R1701:Tmc8 UTSW 11 117791362 splice site probably null
R2425:Tmc8 UTSW 11 117792569 missense probably damaging 0.96
R2509:Tmc8 UTSW 11 117792685 missense possibly damaging 0.66
R4747:Tmc8 UTSW 11 117792724 missense probably benign 0.27
R4783:Tmc8 UTSW 11 117791605 splice site probably null
R5821:Tmc8 UTSW 11 117792629 nonsense probably null
R5923:Tmc8 UTSW 11 117783812 missense probably damaging 1.00
R6381:Tmc8 UTSW 11 117791600 missense probably null 0.73
R6712:Tmc8 UTSW 11 117784813 missense probably benign 0.43
R7351:Tmc8 UTSW 11 117783828 missense probably damaging 1.00
R7493:Tmc8 UTSW 11 117784932 missense probably benign 0.00
R7818:Tmc8 UTSW 11 117792127 missense probably damaging 1.00
R8190:Tmc8 UTSW 11 117791360 critical splice donor site probably null
R8699:Tmc8 UTSW 11 117783535 missense possibly damaging 0.71
R8780:Tmc8 UTSW 11 117790732 frame shift probably null
Z1176:Tmc8 UTSW 11 117786409 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04