Incidental Mutation 'RF021:Sema3g'
ID603897
Institutional Source Beutler Lab
Gene Symbol Sema3g
Ensembl Gene ENSMUSG00000021904
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31217860-31230352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31227841 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 660 (H660Y)
Ref Sequence ENSEMBL: ENSMUSP00000087643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090180]
Predicted Effect probably damaging
Transcript: ENSMUST00000090180
AA Change: H660Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087643
Gene: ENSMUSG00000021904
AA Change: H660Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 503 2.96e-184 SMART
PSI 521 574 3.2e-11 SMART
IG 588 674 6.41e-2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcription of this gene is activated by PPAR-gamma, and the resulting protein product plays a role in endothelial cell migration. Expression of this gene also inhibits tumor cell migration and invasion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity with decreased lymphatic width. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Sema3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Sema3g APN 14 31221727 missense probably damaging 1.00
IGL01650:Sema3g APN 14 31221787 missense probably benign 0.00
IGL01782:Sema3g APN 14 31227791 missense probably damaging 1.00
IGL01784:Sema3g APN 14 31222967 missense probably damaging 1.00
IGL01869:Sema3g APN 14 31223667 missense probably damaging 1.00
IGL01999:Sema3g APN 14 31217965 missense probably benign
IGL02095:Sema3g APN 14 31227824 missense probably benign 0.00
IGL02232:Sema3g APN 14 31221224 missense probably damaging 1.00
IGL02477:Sema3g APN 14 31227866 missense probably damaging 0.98
IGL02583:Sema3g APN 14 31221519 critical splice acceptor site probably null
R0791:Sema3g UTSW 14 31220904 splice site probably benign
R1225:Sema3g UTSW 14 31220679 missense probably damaging 1.00
R1471:Sema3g UTSW 14 31228045 missense probably damaging 1.00
R2303:Sema3g UTSW 14 31222615 missense probably damaging 1.00
R3968:Sema3g UTSW 14 31226521 critical splice donor site probably null
R3970:Sema3g UTSW 14 31226521 critical splice donor site probably null
R4406:Sema3g UTSW 14 31228159 missense probably benign 0.01
R4773:Sema3g UTSW 14 31220709 missense probably benign 0.04
R7968:Sema3g UTSW 14 31220648 missense probably damaging 0.99
R8179:Sema3g UTSW 14 31220585 missense probably benign 0.00
X0013:Sema3g UTSW 14 31222111 missense probably benign 0.02
Z1177:Sema3g UTSW 14 31226397 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACCCGAGAATGGCAAACGTG -3'
(R):5'- GTTCACAGTACTCATCCACACG -3'

Sequencing Primer
(F):5'- CGTGGAAAAAGGAGTAAAGATCAC -3'
(R):5'- TACTCATCCACACGGGGCAG -3'
Posted On2019-12-04