Incidental Mutation 'RF021:Gm7247'
ID 603898
Institutional Source Beutler Lab
Gene Symbol Gm7247
Ensembl Gene ENSMUSG00000068399
Gene Name predicted gene 7247
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock # RF021 (G1)
Quality Score 214.458
Status Not validated
Chromosome 14
Chromosomal Location 51361756-51569982 bp(+) (GRCm38)
Type of Mutation small deletion (3 aa in frame mutation)
DNA Base Change (assembly) AGACCAGACC to A at 51364324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162998]
AlphaFold Q6UY52
Predicted Effect probably benign
Transcript: ENSMUST00000162998
SMART Domains Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

Pfam:Takusan 35 115 2.2e-25 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Gm7247
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gm7247 APN 14 51523505 missense possibly damaging 0.73
IGL01776:Gm7247 APN 14 51521899 missense possibly damaging 0.86
IGL01836:Gm7247 APN 14 51365396 missense probably damaging 1.00
IGL02270:Gm7247 APN 14 51521884 missense probably benign 0.10
IGL02961:Gm7247 APN 14 51365355 missense probably damaging 1.00
IGL03390:Gm7247 APN 14 51523457 missense probably benign
R0054:Gm7247 UTSW 14 51569600 utr 3 prime probably benign
R0413:Gm7247 UTSW 14 51523472 missense probably benign 0.33
R1143:Gm7247 UTSW 14 51523418 missense probably benign 0.33
R2018:Gm7247 UTSW 14 51365347 missense possibly damaging 0.60
R2019:Gm7247 UTSW 14 51365347 missense possibly damaging 0.60
R2117:Gm7247 UTSW 14 51365335 missense probably damaging 0.99
R3971:Gm7247 UTSW 14 51365384 missense probably damaging 1.00
R4649:Gm7247 UTSW 14 51569594 critical splice acceptor site probably null
R5109:Gm7247 UTSW 14 51365317 missense probably damaging 0.98
R5773:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5775:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5776:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5994:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5995:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R5996:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6008:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6009:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6010:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6011:Gm7247 UTSW 14 51364348 missense probably benign 0.01
R6193:Gm7247 UTSW 14 51521842 missense possibly damaging 0.89
R6986:Gm7247 UTSW 14 51365375 missense possibly damaging 0.95
R7226:Gm7247 UTSW 14 51365351 missense probably damaging 0.97
R7331:Gm7247 UTSW 14 51364335 missense probably damaging 0.98
R8878:Gm7247 UTSW 14 51428753 intron probably benign
RF046:Gm7247 UTSW 14 51364324 small deletion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04