Incidental Mutation 'RF021:Fam131a'
ID 603902
Institutional Source Beutler Lab
Gene Symbol Fam131a
Ensembl Gene ENSMUSG00000050821
Gene Name family with sequence similarity 131, member A
Synonyms 2900046G09Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # RF021 (G1)
Quality Score 128.008
Status Validated
Chromosome 16
Chromosomal Location 20511991-20521798 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to C at 20513690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000056518] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000118919] [ENSMUST00000128273] [ENSMUST00000143939] [ENSMUST00000149543] [ENSMUST00000156226] [ENSMUST00000232207]
AlphaFold Q8BWU3
Predicted Effect probably benign
Transcript: ENSMUST00000044783
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056518
SMART Domains Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
Pfam:FAM131 80 356 6.4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073840
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115457
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115460
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115461
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115463
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128273
SMART Domains Protein: ENSMUSP00000120596
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 202 4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143939
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149543
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232207
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Fam131a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0141:Fam131a UTSW 16 20,517,738 (GRCm39) missense probably benign 0.30
R3607:Fam131a UTSW 16 20,520,345 (GRCm39) missense probably damaging 1.00
R3806:Fam131a UTSW 16 20,514,608 (GRCm39) missense probably benign 0.45
R5672:Fam131a UTSW 16 20,518,389 (GRCm39) missense probably damaging 1.00
R7485:Fam131a UTSW 16 20,520,444 (GRCm39) missense probably benign 0.06
R7867:Fam131a UTSW 16 20,514,584 (GRCm39) missense probably benign 0.05
R9282:Fam131a UTSW 16 20,520,243 (GRCm39) missense possibly damaging 0.91
R9308:Fam131a UTSW 16 20,520,582 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAGTACCAGGTAGGCGTC -3'
(R):5'- AGCACAGAAATCATAGGCATGC -3'

Sequencing Primer
(F):5'- GCATAGCCAGTAACCTGTTTTC -3'
(R):5'- CTGGCTGTGTTGATGCAGAGAG -3'
Posted On 2019-12-04