Incidental Mutation 'RF021:Fam131a'
ID603902
Institutional Source Beutler Lab
Gene Symbol Fam131a
Ensembl Gene ENSMUSG00000050821
Gene Namefamily with sequence similarity 131, member A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #RF021 (G1)
Quality Score128.008
Status Validated
Chromosome16
Chromosomal Location20693241-20703048 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 20694940 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000056518] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000118919] [ENSMUST00000128273] [ENSMUST00000143939] [ENSMUST00000149543] [ENSMUST00000156226] [ENSMUST00000232207]
Predicted Effect probably benign
Transcript: ENSMUST00000044783
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056518
SMART Domains Protein: ENSMUSP00000060194
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
low complexity region 45 60 N/A INTRINSIC
Pfam:FAM131 80 356 6.4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073840
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115457
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115460
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115461
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115463
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128273
SMART Domains Protein: ENSMUSP00000120596
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 202 4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143939
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149543
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232207
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Fam131a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0141:Fam131a UTSW 16 20698988 missense probably benign 0.30
R3607:Fam131a UTSW 16 20701595 missense probably damaging 1.00
R3806:Fam131a UTSW 16 20695858 missense probably benign 0.45
R5672:Fam131a UTSW 16 20699639 missense probably damaging 1.00
R7485:Fam131a UTSW 16 20701694 missense probably benign 0.06
R7867:Fam131a UTSW 16 20695834 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGAGTACCAGGTAGGCGTC -3'
(R):5'- AGCACAGAAATCATAGGCATGC -3'

Sequencing Primer
(F):5'- GCATAGCCAGTAACCTGTTTTC -3'
(R):5'- CTGGCTGTGTTGATGCAGAGAG -3'
Posted On2019-12-04