Incidental Mutation 'RF021:Cpn2'
ID 603903
Institutional Source Beutler Lab
Gene Symbol Cpn2
Ensembl Gene ENSMUSG00000023176
Gene Name carboxypeptidase N, polypeptide 2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 30256378-30267499 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30259338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 515 (A515V)
Ref Sequence ENSEMBL: ENSMUSP00000069318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064856]
AlphaFold Q9DBB9
Predicted Effect probably benign
Transcript: ENSMUST00000064856
AA Change: A515V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069318
Gene: ENSMUSG00000023176
AA Change: A515V

LRRNT 21 53 3.21e-8 SMART
LRR 96 119 1.22e2 SMART
LRR 120 143 5.11e0 SMART
LRR_TYP 144 167 2.71e-2 SMART
LRR_TYP 168 191 3.21e-4 SMART
LRR_TYP 192 215 5.9e-3 SMART
LRR_TYP 216 239 6.88e-4 SMART
LRR 240 263 6.57e-1 SMART
LRR_TYP 264 287 2.12e-4 SMART
LRR 289 311 3.07e-1 SMART
LRR_TYP 312 335 2.61e-4 SMART
LRR_TYP 336 359 5.9e-3 SMART
LRR_TYP 360 383 2.79e-4 SMART
LRRCT 395 446 7.34e-9 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Cpn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Cpn2 APN 16 30260520 missense probably benign 0.42
IGL01954:Cpn2 APN 16 30260320 missense probably benign 0.01
IGL02458:Cpn2 APN 16 30260835 missense probably benign 0.00
IGL03036:Cpn2 APN 16 30260829 missense probably benign 0.00
BB002:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
BB012:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
R0118:Cpn2 UTSW 16 30260368 missense probably benign 0.04
R0541:Cpn2 UTSW 16 30259351 missense possibly damaging 0.73
R1300:Cpn2 UTSW 16 30259663 missense probably benign 0.01
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1470:Cpn2 UTSW 16 30260185 missense probably benign 0.00
R1751:Cpn2 UTSW 16 30259667 nonsense probably null
R1753:Cpn2 UTSW 16 30260100 missense probably damaging 1.00
R1761:Cpn2 UTSW 16 30260196 missense probably damaging 1.00
R1767:Cpn2 UTSW 16 30259667 nonsense probably null
R1793:Cpn2 UTSW 16 30259324 missense probably damaging 1.00
R2360:Cpn2 UTSW 16 30259503 missense probably benign 0.01
R2414:Cpn2 UTSW 16 30260574 missense probably benign 0.41
R3842:Cpn2 UTSW 16 30260518 missense probably damaging 1.00
R4934:Cpn2 UTSW 16 30260526 missense probably damaging 1.00
R4956:Cpn2 UTSW 16 30260415 missense possibly damaging 0.56
R5593:Cpn2 UTSW 16 30260080 missense probably benign 0.02
R5864:Cpn2 UTSW 16 30259683 missense probably damaging 1.00
R6755:Cpn2 UTSW 16 30260331 missense probably damaging 1.00
R7833:Cpn2 UTSW 16 30260345 missense probably damaging 1.00
R7925:Cpn2 UTSW 16 30260801 missense probably damaging 1.00
R8441:Cpn2 UTSW 16 30260031 missense probably damaging 1.00
R8679:Cpn2 UTSW 16 30259267 missense possibly damaging 0.90
R8844:Cpn2 UTSW 16 30259297 missense probably damaging 1.00
R9406:Cpn2 UTSW 16 30259542 missense probably benign 0.02
R9523:Cpn2 UTSW 16 30259941 missense possibly damaging 0.89
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04