Incidental Mutation 'RF021:Prdm15'
ID603905
Institutional Source Beutler Lab
Gene Symbol Prdm15
Ensembl Gene ENSMUSG00000014039
Gene NamePR domain containing 15
SynonymsZfp298, E130018M06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF021 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location97791467-97851850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97808756 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 563 (H563Y)
Ref Sequence ENSEMBL: ENSMUSP00000113791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095849] [ENSMUST00000121584] [ENSMUST00000142295]
Predicted Effect probably damaging
Transcript: ENSMUST00000095849
AA Change: H589Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093533
Gene: ENSMUSG00000014039
AA Change: H589Y

DomainStartEndE-ValueType
SET 75 191 5.96e-1 SMART
ZnF_C2H2 223 245 3.99e0 SMART
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 402 424 3.89e-3 SMART
ZnF_C2H2 434 457 2.75e-3 SMART
ZnF_C2H2 468 488 1.88e2 SMART
ZnF_C2H2 495 517 5.42e-2 SMART
ZnF_C2H2 522 544 1.36e-2 SMART
ZnF_C2H2 571 593 6.23e-2 SMART
ZnF_C2H2 598 620 2.75e-3 SMART
low complexity region 642 657 N/A INTRINSIC
ZnF_C2H2 661 684 2.17e-1 SMART
ZnF_C2H2 689 711 3.24e0 SMART
ZnF_C2H2 725 747 1.38e-3 SMART
ZnF_C2H2 753 775 5.67e-5 SMART
ZnF_C2H2 781 803 3.11e-2 SMART
ZnF_C2H2 809 831 8.34e-3 SMART
ZnF_C2H2 837 859 4.79e-3 SMART
ZnF_C2H2 865 888 4.79e-3 SMART
ZnF_C2H2 894 917 5.06e-2 SMART
low complexity region 948 959 N/A INTRINSIC
low complexity region 1148 1170 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121584
AA Change: H563Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113791
Gene: ENSMUSG00000014039
AA Change: H563Y

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
ZnF_C2H2 197 219 3.99e0 SMART
low complexity region 264 277 N/A INTRINSIC
ZnF_C2H2 376 398 3.89e-3 SMART
ZnF_C2H2 408 431 2.75e-3 SMART
ZnF_C2H2 442 462 1.88e2 SMART
ZnF_C2H2 469 491 5.42e-2 SMART
ZnF_C2H2 496 518 1.36e-2 SMART
ZnF_C2H2 545 567 6.23e-2 SMART
ZnF_C2H2 572 594 2.75e-3 SMART
low complexity region 616 631 N/A INTRINSIC
ZnF_C2H2 635 658 2.17e-1 SMART
ZnF_C2H2 663 685 3.24e0 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 5.67e-5 SMART
ZnF_C2H2 755 777 3.11e-2 SMART
ZnF_C2H2 783 805 8.34e-3 SMART
ZnF_C2H2 811 833 4.79e-3 SMART
ZnF_C2H2 839 862 4.79e-3 SMART
ZnF_C2H2 868 891 5.06e-2 SMART
low complexity region 922 933 N/A INTRINSIC
low complexity region 1122 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142295
SMART Domains Protein: ENSMUSP00000120497
Gene: ENSMUSG00000014039

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
low complexity region 230 243 N/A INTRINSIC
ZnF_C2H2 342 364 3.89e-3 SMART
ZnF_C2H2 369 392 2.75e-3 SMART
ZnF_C2H2 403 423 1.88e2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,630,997 probably benign Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Prdm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Prdm15 APN 16 97806167 splice site probably benign
IGL01325:Prdm15 APN 16 97806517 missense probably damaging 1.00
IGL02195:Prdm15 APN 16 97835829 missense probably damaging 1.00
IGL02473:Prdm15 APN 16 97837605 unclassified probably null
IGL02502:Prdm15 APN 16 97839339 missense probably damaging 1.00
IGL02604:Prdm15 APN 16 97821942 missense probably benign
R0408:Prdm15 UTSW 16 97835786 missense possibly damaging 0.92
R0437:Prdm15 UTSW 16 97812559 missense probably benign 0.00
R0497:Prdm15 UTSW 16 97794334 missense possibly damaging 0.63
R0590:Prdm15 UTSW 16 97797761 missense possibly damaging 0.95
R0630:Prdm15 UTSW 16 97837707 missense probably null 1.00
R0661:Prdm15 UTSW 16 97829682 missense probably benign 0.34
R0718:Prdm15 UTSW 16 97812633 missense possibly damaging 0.89
R1144:Prdm15 UTSW 16 97808708 missense probably damaging 1.00
R1240:Prdm15 UTSW 16 97837600 missense probably damaging 0.98
R1605:Prdm15 UTSW 16 97839306 missense probably damaging 1.00
R1908:Prdm15 UTSW 16 97837685 missense probably benign 0.27
R2081:Prdm15 UTSW 16 97803780 nonsense probably null
R2208:Prdm15 UTSW 16 97799264 intron probably null
R3787:Prdm15 UTSW 16 97797745 missense probably benign 0.00
R3890:Prdm15 UTSW 16 97799571 missense probably damaging 1.00
R4326:Prdm15 UTSW 16 97806515 missense probably damaging 1.00
R4728:Prdm15 UTSW 16 97821786 missense probably benign 0.04
R4952:Prdm15 UTSW 16 97806077 missense probably damaging 0.99
R4998:Prdm15 UTSW 16 97794489 missense probably damaging 0.97
R5225:Prdm15 UTSW 16 97808675 missense probably damaging 1.00
R5505:Prdm15 UTSW 16 97816983 missense possibly damaging 0.76
R5628:Prdm15 UTSW 16 97799623 missense probably damaging 0.98
R5721:Prdm15 UTSW 16 97807096 missense possibly damaging 0.74
R5873:Prdm15 UTSW 16 97808689 missense probably damaging 1.00
R5980:Prdm15 UTSW 16 97812570 nonsense probably null
R6311:Prdm15 UTSW 16 97799055 missense probably null 0.08
R6540:Prdm15 UTSW 16 97835805 missense probably benign 0.13
R7053:Prdm15 UTSW 16 97794542 nonsense probably null
R7241:Prdm15 UTSW 16 97795741 missense possibly damaging 0.50
R7468:Prdm15 UTSW 16 97835642 nonsense probably null
R7473:Prdm15 UTSW 16 97821846 missense possibly damaging 0.68
R7762:Prdm15 UTSW 16 97818273 missense probably benign 0.00
R7911:Prdm15 UTSW 16 97812592 missense probably benign 0.35
R8053:Prdm15 UTSW 16 97835607 missense probably benign 0.17
R8127:Prdm15 UTSW 16 97837710 missense probably benign 0.24
R8213:Prdm15 UTSW 16 97807060 missense probably damaging 1.00
RF002:Prdm15 UTSW 16 97799629 missense probably damaging 1.00
Z1177:Prdm15 UTSW 16 97816959 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCTGGTAAGTGCCTCATCTATGTAC -3'
(R):5'- TACTCCATTGCAGCAGAGGC -3'

Sequencing Primer
(F):5'- TATGTACTAAGAGATACTGCCCCAGG -3'
(R):5'- CAGCGTGTCTGTTGTGGTG -3'
Posted On2019-12-04