Incidental Mutation 'RF021:Prdm15'
ID 603905
Institutional Source Beutler Lab
Gene Symbol Prdm15
Ensembl Gene ENSMUSG00000014039
Gene Name PR domain containing 15
Synonyms Zfp298, E130018M06Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 97592667-97653050 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97609956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 563 (H563Y)
Ref Sequence ENSEMBL: ENSMUSP00000113791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095849] [ENSMUST00000121584] [ENSMUST00000142295]
AlphaFold E9Q8T2
Predicted Effect probably damaging
Transcript: ENSMUST00000095849
AA Change: H589Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093533
Gene: ENSMUSG00000014039
AA Change: H589Y

DomainStartEndE-ValueType
SET 75 191 5.96e-1 SMART
ZnF_C2H2 223 245 3.99e0 SMART
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 402 424 3.89e-3 SMART
ZnF_C2H2 434 457 2.75e-3 SMART
ZnF_C2H2 468 488 1.88e2 SMART
ZnF_C2H2 495 517 5.42e-2 SMART
ZnF_C2H2 522 544 1.36e-2 SMART
ZnF_C2H2 571 593 6.23e-2 SMART
ZnF_C2H2 598 620 2.75e-3 SMART
low complexity region 642 657 N/A INTRINSIC
ZnF_C2H2 661 684 2.17e-1 SMART
ZnF_C2H2 689 711 3.24e0 SMART
ZnF_C2H2 725 747 1.38e-3 SMART
ZnF_C2H2 753 775 5.67e-5 SMART
ZnF_C2H2 781 803 3.11e-2 SMART
ZnF_C2H2 809 831 8.34e-3 SMART
ZnF_C2H2 837 859 4.79e-3 SMART
ZnF_C2H2 865 888 4.79e-3 SMART
ZnF_C2H2 894 917 5.06e-2 SMART
low complexity region 948 959 N/A INTRINSIC
low complexity region 1148 1170 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121584
AA Change: H563Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113791
Gene: ENSMUSG00000014039
AA Change: H563Y

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
ZnF_C2H2 197 219 3.99e0 SMART
low complexity region 264 277 N/A INTRINSIC
ZnF_C2H2 376 398 3.89e-3 SMART
ZnF_C2H2 408 431 2.75e-3 SMART
ZnF_C2H2 442 462 1.88e2 SMART
ZnF_C2H2 469 491 5.42e-2 SMART
ZnF_C2H2 496 518 1.36e-2 SMART
ZnF_C2H2 545 567 6.23e-2 SMART
ZnF_C2H2 572 594 2.75e-3 SMART
low complexity region 616 631 N/A INTRINSIC
ZnF_C2H2 635 658 2.17e-1 SMART
ZnF_C2H2 663 685 3.24e0 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 5.67e-5 SMART
ZnF_C2H2 755 777 3.11e-2 SMART
ZnF_C2H2 783 805 8.34e-3 SMART
ZnF_C2H2 811 833 4.79e-3 SMART
ZnF_C2H2 839 862 4.79e-3 SMART
ZnF_C2H2 868 891 5.06e-2 SMART
low complexity region 922 933 N/A INTRINSIC
low complexity region 1122 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142295
SMART Domains Protein: ENSMUSP00000120497
Gene: ENSMUSG00000014039

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
low complexity region 230 243 N/A INTRINSIC
ZnF_C2H2 342 364 3.89e-3 SMART
ZnF_C2H2 369 392 2.75e-3 SMART
ZnF_C2H2 403 423 1.88e2 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gstp1 A T 19: 4,085,507 (GRCm39) V200E probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Prdm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Prdm15 APN 16 97,607,367 (GRCm39) splice site probably benign
IGL01325:Prdm15 APN 16 97,607,717 (GRCm39) missense probably damaging 1.00
IGL02195:Prdm15 APN 16 97,637,029 (GRCm39) missense probably damaging 1.00
IGL02473:Prdm15 APN 16 97,638,805 (GRCm39) splice site probably null
IGL02502:Prdm15 APN 16 97,640,539 (GRCm39) missense probably damaging 1.00
IGL02604:Prdm15 APN 16 97,623,142 (GRCm39) missense probably benign
R0408:Prdm15 UTSW 16 97,636,986 (GRCm39) missense possibly damaging 0.92
R0437:Prdm15 UTSW 16 97,613,759 (GRCm39) missense probably benign 0.00
R0497:Prdm15 UTSW 16 97,595,534 (GRCm39) missense possibly damaging 0.63
R0590:Prdm15 UTSW 16 97,598,961 (GRCm39) missense possibly damaging 0.95
R0630:Prdm15 UTSW 16 97,638,907 (GRCm39) missense probably null 1.00
R0661:Prdm15 UTSW 16 97,630,882 (GRCm39) missense probably benign 0.34
R0718:Prdm15 UTSW 16 97,613,833 (GRCm39) missense possibly damaging 0.89
R1144:Prdm15 UTSW 16 97,609,908 (GRCm39) missense probably damaging 1.00
R1240:Prdm15 UTSW 16 97,638,800 (GRCm39) missense probably damaging 0.98
R1605:Prdm15 UTSW 16 97,640,506 (GRCm39) missense probably damaging 1.00
R1908:Prdm15 UTSW 16 97,638,885 (GRCm39) missense probably benign 0.27
R2081:Prdm15 UTSW 16 97,604,980 (GRCm39) nonsense probably null
R2208:Prdm15 UTSW 16 97,600,464 (GRCm39) splice site probably null
R3787:Prdm15 UTSW 16 97,598,945 (GRCm39) missense probably benign 0.00
R3890:Prdm15 UTSW 16 97,600,771 (GRCm39) missense probably damaging 1.00
R4326:Prdm15 UTSW 16 97,607,715 (GRCm39) missense probably damaging 1.00
R4728:Prdm15 UTSW 16 97,622,986 (GRCm39) missense probably benign 0.04
R4952:Prdm15 UTSW 16 97,607,277 (GRCm39) missense probably damaging 0.99
R4998:Prdm15 UTSW 16 97,595,689 (GRCm39) missense probably damaging 0.97
R5225:Prdm15 UTSW 16 97,609,875 (GRCm39) missense probably damaging 1.00
R5505:Prdm15 UTSW 16 97,618,183 (GRCm39) missense possibly damaging 0.76
R5628:Prdm15 UTSW 16 97,600,823 (GRCm39) missense probably damaging 0.98
R5721:Prdm15 UTSW 16 97,608,296 (GRCm39) missense possibly damaging 0.74
R5873:Prdm15 UTSW 16 97,609,889 (GRCm39) missense probably damaging 1.00
R5980:Prdm15 UTSW 16 97,613,770 (GRCm39) nonsense probably null
R6311:Prdm15 UTSW 16 97,600,255 (GRCm39) missense probably null 0.08
R6540:Prdm15 UTSW 16 97,637,005 (GRCm39) missense probably benign 0.13
R7053:Prdm15 UTSW 16 97,595,742 (GRCm39) nonsense probably null
R7241:Prdm15 UTSW 16 97,596,941 (GRCm39) missense possibly damaging 0.50
R7468:Prdm15 UTSW 16 97,636,842 (GRCm39) nonsense probably null
R7473:Prdm15 UTSW 16 97,623,046 (GRCm39) missense possibly damaging 0.68
R7762:Prdm15 UTSW 16 97,619,473 (GRCm39) missense probably benign 0.00
R7911:Prdm15 UTSW 16 97,613,792 (GRCm39) missense probably benign 0.35
R8053:Prdm15 UTSW 16 97,636,807 (GRCm39) missense probably benign 0.17
R8127:Prdm15 UTSW 16 97,638,910 (GRCm39) missense probably benign 0.24
R8213:Prdm15 UTSW 16 97,608,260 (GRCm39) missense probably damaging 1.00
R8708:Prdm15 UTSW 16 97,618,066 (GRCm39) missense unknown
R8768:Prdm15 UTSW 16 97,638,888 (GRCm39) missense probably benign
R9000:Prdm15 UTSW 16 97,595,470 (GRCm39) missense probably benign 0.03
R9513:Prdm15 UTSW 16 97,607,704 (GRCm39) missense probably damaging 1.00
R9583:Prdm15 UTSW 16 97,623,142 (GRCm39) missense probably benign
RF002:Prdm15 UTSW 16 97,600,829 (GRCm39) missense probably damaging 1.00
Z1177:Prdm15 UTSW 16 97,618,159 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCTGGTAAGTGCCTCATCTATGTAC -3'
(R):5'- TACTCCATTGCAGCAGAGGC -3'

Sequencing Primer
(F):5'- TATGTACTAAGAGATACTGCCCCAGG -3'
(R):5'- CAGCGTGTCTGTTGTGGTG -3'
Posted On 2019-12-04