Incidental Mutation 'RF021:Kcnh8'
ID 603908
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms ELK1, C130090D05Rik, Kv12.1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 52602709-52979194 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52978239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1079 (R1079H)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039366
AA Change: R1079H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: R1079H

Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
R7952:Kcnh8 UTSW 17 52959465 missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52978094 missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52956908 missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52905073 missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52978292 missense probably benign
R8716:Kcnh8 UTSW 17 52977752 missense probably benign 0.02
R8943:Kcnh8 UTSW 17 52797458 missense probably benign 0.00
R9051:Kcnh8 UTSW 17 52834614 missense probably damaging 1.00
R9211:Kcnh8 UTSW 17 52839208 missense probably damaging 1.00
R9233:Kcnh8 UTSW 17 52978140 missense probably damaging 1.00
R9243:Kcnh8 UTSW 17 52898514 missense probably damaging 1.00
R9327:Kcnh8 UTSW 17 52839056 missense probably damaging 0.99
R9640:Kcnh8 UTSW 17 52878061 missense probably damaging 1.00
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04