Incidental Mutation 'RF021:Gstp1'
ID 603909
Institutional Source Beutler Lab
Gene Symbol Gstp1
Ensembl Gene ENSMUSG00000060803
Gene Name glutathione S-transferase, pi 1
Synonyms Gst p-1, GstpiB
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.331) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4085411-4087912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4085507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 200 (V200E)
Ref Sequence ENSEMBL: ENSMUSP00000129565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042700] [ENSMUST00000169613]
AlphaFold P19157
PDB Structure GLUTATHIONE S-TRANSFERASE YFYF CYS 47-CARBOXYMETHYLATED CLASS PI, FREE ENZYME [X-RAY DIFFRACTION]
1.8 ANGSTROMS MOLECULAR STRUCTURE OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
1.8 ANGSTROMS MOLECULAR STRUCTURE OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
GLUTATHIONE S-TRANSFERASE YFYF, CLASS PI, COMPLEXED WITH GLUTATHIONE [X-RAY DIFFRACTION]
MODIFIED GLUTATHIONE S-TRANSFERASE (PI) COMPLEXED WITH S (P-NITROBENZYL)GLUTATHIONE [X-RAY DIFFRACTION]
MOLECULAR STRUCTURE AT 1.8 ANGSTROMS OF MOUSE LIVER CLASS PI GLUTATHIONE S-TRANSFERASE COMPLEXED WITH S-(P-NITROBENZYL)GLUTATHIONE AND OTHER INHIBITORS [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-hexyl glutathione [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-(p-nitrobenzyl) Glutathione [X-RAY DIFFRACTION]
Structure of Glutathione-S-Transferase C169A Mutant [X-RAY DIFFRACTION]
1.8 Angstroms molecular structure of mouse liver glutathione S-transferase mutant C47A complexed with S-(P-nitrobenzyl)glutathione [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042700
SMART Domains Protein: ENSMUSP00000038931
Gene: ENSMUSG00000038155

DomainStartEndE-ValueType
Pfam:GST_N 2 75 4.2e-8 PFAM
Pfam:GST_C 97 188 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169613
AA Change: V200E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129565
Gene: ENSMUSG00000060803
AA Change: V200E

DomainStartEndE-ValueType
Pfam:GST_N 4 75 2.3e-8 PFAM
Pfam:GST_C 97 188 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype PHENOTYPE: Mutant mice with null mutations in both Gstp1 and Gstp2 exhibit an increased susceptibility to DMBA and TPA induced skin papillomas. Male mutant mice exhibit an increased body weight with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,891,290 (GRCm39) probably benign Het
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
Ankrd44 T C 1: 54,817,471 (GRCm39) H79R probably damaging Het
Atg9a T A 1: 75,159,273 (GRCm39) E826V probably damaging Het
Atrnl1 T C 19: 57,630,905 (GRCm39) V224A probably benign Het
Bltp1 TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,104,897 (GRCm39) probably benign Het
Cpn2 G A 16: 30,078,156 (GRCm39) A515V probably benign Het
Cyp2a12 T C 7: 26,734,785 (GRCm39) F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,327,752 (GRCm39) probably benign Het
Dnah10 G T 5: 124,854,971 (GRCm39) V2016F probably damaging Het
Dock10 T C 1: 80,542,290 (GRCm39) probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,602,084 (GRCm39) probably benign Het
Fam131a A C 16: 20,513,690 (GRCm39) probably benign Het
Gm7247 AGACCAGACC A 14: 51,601,781 (GRCm39) probably benign Het
Gna13 T C 11: 109,283,218 (GRCm39) V186A probably benign Het
Grk3 T A 5: 113,089,554 (GRCm39) I333L probably benign Het
Gtf2h1 T G 7: 46,453,289 (GRCm39) V74G possibly damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Kiz A G 2: 146,712,750 (GRCm39) D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,285,782 (GRCm39) probably benign Het
Lats1 A G 10: 7,586,372 (GRCm39) T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 92,925,576 (GRCm39) probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 92,925,602 (GRCm39) probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,810,744 (GRCm39) probably null Het
Med12l T C 3: 58,980,711 (GRCm39) F359S probably benign Het
Mmut A G 17: 41,262,649 (GRCm39) I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,219,333 (GRCm39) probably benign Het
Ngp A G 9: 110,250,824 (GRCm39) T114A possibly damaging Het
Nlrc5 A T 8: 95,203,516 (GRCm39) T539S probably benign Het
Nxf1 A G 19: 8,749,673 (GRCm39) D190G probably damaging Het
Or6c2b A T 10: 128,948,211 (GRCm39) F28I probably damaging Het
Or8g2 A T 9: 39,821,341 (GRCm39) M81L probably benign Het
Pramel16 C G 4: 143,675,478 (GRCm39) Q449H probably damaging Het
Prdm15 G A 16: 97,609,956 (GRCm39) H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 155,938,026 (GRCm39) probably benign Het
Sema3g C T 14: 30,949,798 (GRCm39) H660Y probably damaging Het
Slco1a8 A T 6: 141,954,440 (GRCm39) V31E probably damaging Het
Smarca2 AGCAGCAGCAGCAGCAGCAGCA AGCAGCAGCAGCAGCAGCAGCAGCAGCA 19: 26,608,397 (GRCm39) probably benign Het
Stpg2 A T 3: 138,918,011 (GRCm39) probably null Het
Taar7f C T 10: 23,926,321 (GRCm39) T305M possibly damaging Het
Tbcb C T 7: 29,923,771 (GRCm39) V208M probably damaging Het
Tenm2 T A 11: 35,915,030 (GRCm39) Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 (GRCm39) V108A probably damaging Het
Tmc8 T C 11: 117,674,060 (GRCm39) M42T probably benign Het
Trdc T C 14: 54,381,660 (GRCm39) V115A Het
Ttbk2 A G 2: 120,579,115 (GRCm39) V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,223,553 (GRCm39) probably benign Het
Utp25 A G 1: 192,802,974 (GRCm39) F248L probably benign Het
Vps16 A G 2: 130,280,129 (GRCm39) H118R probably benign Het
Wdpcp T A 11: 21,661,587 (GRCm39) C286* probably null Het
Zbed4 C A 15: 88,665,439 (GRCm39) Y502* probably null Het
Zdbf2 T A 1: 63,341,811 (GRCm39) N63K possibly damaging Het
Other mutations in Gstp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1658:Gstp1 UTSW 19 4,087,375 (GRCm39) missense probably damaging 0.99
R1848:Gstp1 UTSW 19 4,086,795 (GRCm39) splice site probably benign
R3432:Gstp1 UTSW 19 4,086,695 (GRCm39) missense possibly damaging 0.50
R6634:Gstp1 UTSW 19 4,085,510 (GRCm39) missense probably benign 0.21
R8755:Gstp1 UTSW 19 4,086,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCACCCTTATGTGCAAG -3'
(R):5'- GGCAAAGCTTTCATCGTGGG -3'

Sequencing Primer
(F):5'- ACCCTTATGTGCAAGTTTCCTG -3'
(R):5'- GACCAGGTGAGCATCTCTTG -3'
Posted On 2019-12-04