Incidental Mutation 'RF021:Gstp1'
Institutional Source Beutler Lab
Gene Symbol Gstp1
Ensembl Gene ENSMUSG00000060803
Gene Nameglutathione S-transferase, pi 1
SynonymsGstpiB, Gst p-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #RF021 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location4035407-4037921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4035507 bp
Amino Acid Change Valine to Glutamic Acid at position 200 (V200E)
Ref Sequence ENSEMBL: ENSMUSP00000129565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042700] [ENSMUST00000169613]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-hexyl glutathione [X-RAY DIFFRACTION]
Mouse C14A Glutathione-S-Transferase Mutant in Complex with S-(p-nitrobenzyl) Glutathione [X-RAY DIFFRACTION]
Structure of Glutathione-S-Transferase C169A Mutant [X-RAY DIFFRACTION]
1.8 Angstroms molecular structure of mouse liver glutathione S-transferase mutant C47A complexed with S-(P-nitrobenzyl)glutathione [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042700
SMART Domains Protein: ENSMUSP00000038931
Gene: ENSMUSG00000038155

Pfam:GST_N 2 75 4.2e-8 PFAM
Pfam:GST_C 97 188 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169613
AA Change: V200E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129565
Gene: ENSMUSG00000060803
AA Change: V200E

Pfam:GST_N 4 75 2.3e-8 PFAM
Pfam:GST_C 97 188 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype PHENOTYPE: Mutant mice with null mutations in both Gstp1 and Gstp2 exhibit an increased susceptibility to DMBA and TPA induced skin papillomas. Male mutant mice exhibit an increased body weight with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Nxf1 A G 19: 8,772,309 D190G probably damaging Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Gstp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1658:Gstp1 UTSW 19 4037375 missense probably damaging 0.99
R1848:Gstp1 UTSW 19 4036795 splice site probably benign
R3432:Gstp1 UTSW 19 4036695 missense possibly damaging 0.50
R6634:Gstp1 UTSW 19 4035510 missense probably benign 0.21
R8755:Gstp1 UTSW 19 4036698 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04