Incidental Mutation 'RF021:Nxf1'
ID 603911
Institutional Source Beutler Lab
Gene Symbol Nxf1
Ensembl Gene ENSMUSG00000010097
Gene Name nuclear RNA export factor 1
Synonyms Tip associated protein, Mex67, TAP, Mvb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF021 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 8757073-8772475 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8772309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 190 (D190G)
Ref Sequence ENSEMBL: ENSMUSP00000010248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010241] [ENSMUST00000010248] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000184970] [ENSMUST00000189739]
AlphaFold Q99JX7
Predicted Effect probably benign
Transcript: ENSMUST00000003777
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680

TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000010248
AA Change: D190G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010248
Gene: ENSMUSG00000010097
AA Change: D190G

Pfam:TMEM223 32 197 6.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010249
SMART Domains Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

signal peptide 1 24 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176496
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680

TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176610
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680

TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177056
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680

TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177216
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680

TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184826
Predicted Effect probably benign
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189739
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680

TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency 91% (50/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some alleles are able to suppress defects caused by retrovirus insertion mutations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TTATTATTATTAT TTATTATTATTATTAATATTATTATTAT 3: 37,050,748 probably benign Het
A030005L19Rik GTGGTGGCTG GTGGTGGCTGTGGTGGCTG 1: 82,913,569 probably benign Het
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
Ankrd44 T C 1: 54,778,312 H79R probably damaging Het
Atg9a T A 1: 75,182,629 E826V probably damaging Het
Atrnl1 T C 19: 57,642,473 V224A probably benign Het
Cpn2 G A 16: 30,259,338 A515V probably benign Het
Cyp2a12 T C 7: 27,035,360 F402S possibly damaging Het
Defb22 TGCGGCA TGCGGCAGAGCTGGGCGTTGCGGCA 2: 152,485,832 probably benign Het
Diexf A G 1: 193,120,666 F248L probably benign Het
Dnah10 G T 5: 124,777,907 V2016F probably damaging Het
Dock10 T C 1: 80,564,573 probably null Het
Efhd2 GCC GCCGCCCCC 4: 141,874,773 probably benign Het
Fam131a A C 16: 20,694,940 probably benign Het
Gm6614 A T 6: 142,008,714 V31E probably damaging Het
Gm7247 AGACCAGACC A 14: 51,364,324 probably benign Het
Gna13 T C 11: 109,392,392 V186A probably benign Het
Grk3 T A 5: 112,941,688 I333L probably benign Het
Gstp1 A T 19: 4,035,507 V200E probably benign Het
Gtf2h1 T G 7: 46,803,865 V74G possibly damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Kiz A G 2: 146,870,830 D138G possibly damaging Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Lats1 A G 10: 7,710,608 T912A probably damaging Het
Lce1m GCTGCCACC GCTGCCACCACTTCTGCCACC 3: 93,018,269 probably benign Het
Lce1m TGCC TGCCGCCGCTGCCGCC 3: 93,018,295 probably benign Het
Lrrc2 TTGATTCGGTTCACC T 9: 110,981,676 probably null Het
Med12l T C 3: 59,073,290 F359S probably benign Het
Mut A G 17: 40,951,758 I444V probably benign Het
Ncoa2 CTTAAAA C 1: 13,149,109 probably benign Het
Ngp A G 9: 110,421,756 T114A possibly damaging Het
Nlrc5 A T 8: 94,476,888 T539S probably benign Het
Olfr229 A T 9: 39,910,045 M81L probably benign Het
Olfr769 A T 10: 129,112,342 F28I probably damaging Het
Pramef25 C G 4: 143,948,908 Q449H probably damaging Het
Prdm15 G A 16: 97,808,756 H563Y probably damaging Het
Rbm12 CAGG CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG 2: 156,096,106 probably benign Het
Sema3g C T 14: 31,227,841 H660Y probably damaging Het
Stpg2 A T 3: 139,212,250 probably null Het
Taar7f C T 10: 24,050,423 T305M possibly damaging Het
Tbcb C T 7: 30,224,346 V208M probably damaging Het
Tenm2 T A 11: 36,024,203 Q2169L possibly damaging Het
Tln1 A G 4: 43,555,890 V108A probably damaging Het
Tmc8 T C 11: 117,783,234 M42T probably benign Het
Trdc T C 14: 54,144,203 V115A Het
Ttbk2 A G 2: 120,748,634 V669A probably benign Het
Tusc1 GCC GCCACCACC 4: 93,335,316 probably benign Het
Vps16 A G 2: 130,438,209 H118R probably benign Het
Wdpcp T A 11: 21,711,587 C286* probably null Het
Zbed4 C A 15: 88,781,236 Y502* probably null Het
Zdbf2 T A 1: 63,302,652 N63K possibly damaging Het
Other mutations in Nxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nxf1 APN 19 8762742 missense possibly damaging 0.95
IGL02318:Nxf1 APN 19 8764150 critical splice donor site probably null
IGL03383:Nxf1 APN 19 8763697 missense probably damaging 1.00
Chance UTSW 19 8769182 missense probably damaging 1.00
Necessity UTSW 19 8767754 missense probably damaging 1.00
Possibility UTSW 19 8767744 missense probably damaging 1.00
Probability UTSW 19 8764317 missense probably benign 0.01
R0125:Nxf1 UTSW 19 8762806 missense probably benign 0.37
R0362:Nxf1 UTSW 19 8764151 critical splice donor site probably null
R0374:Nxf1 UTSW 19 8767739 missense possibly damaging 0.86
R0403:Nxf1 UTSW 19 8765028 missense probably damaging 1.00
R0883:Nxf1 UTSW 19 8764591 missense probably damaging 1.00
R1004:Nxf1 UTSW 19 8764317 missense probably benign 0.01
R1068:Nxf1 UTSW 19 8762754 missense probably damaging 0.97
R1503:Nxf1 UTSW 19 8762436 missense probably benign
R1669:Nxf1 UTSW 19 8772131 missense possibly damaging 0.93
R1679:Nxf1 UTSW 19 8769074 missense probably benign
R4424:Nxf1 UTSW 19 8766764 utr 3 prime probably benign
R4608:Nxf1 UTSW 19 8762763 missense probably benign 0.03
R4783:Nxf1 UTSW 19 8766798 missense probably benign 0.01
R4969:Nxf1 UTSW 19 8762305 splice site probably null
R5233:Nxf1 UTSW 19 8763929 missense possibly damaging 0.67
R5370:Nxf1 UTSW 19 8772140 missense probably damaging 1.00
R6024:Nxf1 UTSW 19 8767744 missense probably damaging 1.00
R6058:Nxf1 UTSW 19 8767822 missense probably damaging 1.00
R6063:Nxf1 UTSW 19 8767787 missense possibly damaging 0.46
R6293:Nxf1 UTSW 19 8769182 missense probably damaging 1.00
R6378:Nxf1 UTSW 19 8764546 missense probably benign 0.19
R8170:Nxf1 UTSW 19 8771050 missense probably benign 0.02
R8317:Nxf1 UTSW 19 8771043 missense probably benign
R9110:Nxf1 UTSW 19 8767754 missense probably damaging 1.00
R9506:Nxf1 UTSW 19 8772144 missense probably damaging 0.99
R9701:Nxf1 UTSW 19 8762408 missense probably damaging 1.00
R9802:Nxf1 UTSW 19 8762408 missense probably damaging 1.00
X0024:Nxf1 UTSW 19 8763764 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04