Mutagenetix > Incidental Mutation

Incidental Mutation 'RF021:Atrnl1'

603914

Institutional Source

Beutler Lab

Gene Symbol

Atrnl1

Ensembl Gene

ENSMUSG00000054843

Gene Name

attractin like 1

Synonyms

Alp

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

RF021 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57611034-58133338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57642473 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 224 (V224A)

Ref Sequence

ENSEMBL: ENSMUSP00000076514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077282]

AlphaFold

Q6A051

Predicted Effect

probably benign
Transcript: ENSMUST00000077282
AA Change: V224A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: V224A

Domain	Start	End	E-Value	Type
low complexity region	25	32	N/A	INTRINSIC
EGF	61	90	5.71e-1	SMART
CUB	92	208	1.43e-11	SMART
EGF	209	244	1.95e1	SMART
Pfam:EGF_2	248	279	5.8e-7	PFAM
Pfam:Kelch_5	350	391	2.1e-9	PFAM
Pfam:Kelch_6	354	401	5.8e-8	PFAM
Pfam:Kelch_4	465	517	4.3e-7	PFAM
Pfam:Kelch_1	519	573	2.7e-6	PFAM
PSI	613	656	3.38e-1	SMART
PSI	665	708	2e-3	SMART
PSI	714	759	1.72e-2	SMART
CLECT	747	872	2.86e-20	SMART
PSI	888	938	6.26e-5	SMART
PSI	941	1011	1.73e-7	SMART
EGF_Lam	1013	1056	1.07e-5	SMART
low complexity region	1157	1173	N/A	INTRINSIC
transmembrane domain	1229	1251	N/A	INTRINSIC
low complexity region	1261	1272	N/A	INTRINSIC
low complexity region	1326	1339	N/A	INTRINSIC

Meta Mutation Damage Score

0.0698

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.3%

Validation Efficiency

91% (50/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	TTATTATTATTAT	TTATTATTATTATTAATATTATTATTAT	3: 37,050,748		probably benign	Het
A030005L19Rik	GTGGTGGCTG	GTGGTGGCTGTGGTGGCTG	1: 82,913,569		probably benign	Het
AI837181	CGG	CGGTGG	19: 5,425,234		probably benign	Het
Ankrd44	T	C	1: 54,778,312	H79R	probably damaging	Het
Atg9a	T	A	1: 75,182,629	E826V	probably damaging	Het
Cpn2	G	A	16: 30,259,338	A515V	probably benign	Het
Cyp2a12	T	C	7: 27,035,360	F402S	possibly damaging	Het
Defb22	TGCGGCA	TGCGGCAGAGCTGGGCGTTGCGGCA	2: 152,485,832		probably benign	Het
Diexf	A	G	1: 193,120,666	F248L	probably benign	Het
Dnah10	G	T	5: 124,777,907	V2016F	probably damaging	Het
Dock10	T	C	1: 80,564,573		probably null	Het
Efhd2	GCC	GCCGCCCCC	4: 141,874,773		probably benign	Het
Fam131a	A	C	16: 20,694,940		probably benign	Het
Gm6614	A	T	6: 142,008,714	V31E	probably damaging	Het
Gm7247	AGACCAGACC	A	14: 51,364,324		probably benign	Het
Gna13	T	C	11: 109,392,392	V186A	probably benign	Het
Grk3	T	A	5: 112,941,688	I333L	probably benign	Het
Gstp1	A	T	19: 4,035,507	V200E	probably benign	Het
Gtf2h1	T	G	7: 46,803,865	V74G	possibly damaging	Het
Kcnh8	G	A	17: 52,978,239	R1079H	probably benign	Het
Kiz	A	G	2: 146,870,830	D138G	possibly damaging	Het
Kmt2b	TTCTCCT	TTCTCCTTCTCCT	7: 30,586,357		probably benign	Het
Lats1	A	G	10: 7,710,608	T912A	probably damaging	Het
Lce1m	GCTGCCACC	GCTGCCACCACTTCTGCCACC	3: 93,018,269		probably benign	Het
Lce1m	TGCC	TGCCGCCGCTGCCGCC	3: 93,018,295		probably benign	Het
Lrrc2	TTGATTCGGTTCACC	T	9: 110,981,676		probably null	Het
Med12l	T	C	3: 59,073,290	F359S	probably benign	Het
Mut	A	G	17: 40,951,758	I444V	probably benign	Het
Ncoa2	CTTAAAA	C	1: 13,149,109		probably benign	Het
Ngp	A	G	9: 110,421,756	T114A	possibly damaging	Het
Nlrc5	A	T	8: 94,476,888	T539S	probably benign	Het
Nxf1	A	G	19: 8,772,309	D190G	probably damaging	Het
Olfr229	A	T	9: 39,910,045	M81L	probably benign	Het
Olfr769	A	T	10: 129,112,342	F28I	probably damaging	Het
Pramef25	C	G	4: 143,948,908	Q449H	probably damaging	Het
Prdm15	G	A	16: 97,808,756	H563Y	probably damaging	Het
Rbm12	CAGG	CAGGGATTGCGGGACCTGGTATTGCGGGACCAGG	2: 156,096,106		probably benign	Het
Sema3g	C	T	14: 31,227,841	H660Y	probably damaging	Het
Smarca2	AGCAGCAGCAGCAGCAGCAGCA	AGCAGCAGCAGCAGCAGCAGCAGCAGCA	19: 26,630,997		probably benign	Het
Stpg2	A	T	3: 139,212,250		probably null	Het
Taar7f	C	T	10: 24,050,423	T305M	possibly damaging	Het
Tbcb	C	T	7: 30,224,346	V208M	probably damaging	Het
Tenm2	T	A	11: 36,024,203	Q2169L	possibly damaging	Het
Tln1	A	G	4: 43,555,890	V108A	probably damaging	Het
Tmc8	T	C	11: 117,783,234	M42T	probably benign	Het
Trdc	T	C	14: 54,144,203	V115A		Het
Ttbk2	A	G	2: 120,748,634	V669A	probably benign	Het
Tusc1	GCC	GCCACCACC	4: 93,335,316		probably benign	Het
Vps16	A	G	2: 130,438,209	H118R	probably benign	Het
Wdpcp	T	A	11: 21,711,587	C286*	probably null	Het
Zbed4	C	A	15: 88,781,236	Y502*	probably null	Het
Zdbf2	T	A	1: 63,302,652	N63K	possibly damaging	Het

Other mutations in Atrnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Atrnl1	APN	19	57691817	missense	probably benign	0.02
IGL00707:Atrnl1	APN	19	57673265	missense	probably damaging	0.96
IGL00921:Atrnl1	APN	19	57702153	missense	probably damaging	1.00
IGL01410:Atrnl1	APN	19	58131104	missense	probably damaging	1.00
IGL01468:Atrnl1	APN	19	57699712	missense	probably benign	0.02
IGL01756:Atrnl1	APN	19	57652948	missense	probably benign
IGL01971:Atrnl1	APN	19	57753283	missense	probably damaging	1.00
IGL02019:Atrnl1	APN	19	57691763	splice site	probably benign
IGL02580:Atrnl1	APN	19	57714576	splice site	probably benign
IGL02649:Atrnl1	APN	19	57650441	splice site	probably benign
IGL02676:Atrnl1	APN	19	57691884	missense	probably damaging	1.00
IGL03276:Atrnl1	APN	19	57652927	missense	probably damaging	0.99
IGL03379:Atrnl1	APN	19	57642541	missense	probably benign	0.02
Magnetogorsk	UTSW	19	57630306	missense	probably damaging	1.00
polar	UTSW	19	57652950	missense	probably benign	0.00
PIT4812001:Atrnl1	UTSW	19	57731623	missense	probably benign	0.08
R0109:Atrnl1	UTSW	19	57755517	missense	possibly damaging	0.78
R0308:Atrnl1	UTSW	19	57753288	missense	probably benign	0.04
R0394:Atrnl1	UTSW	19	57673176	missense	probably benign	0.10
R0734:Atrnl1	UTSW	19	57654861	missense	probably damaging	1.00
R0811:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R0812:Atrnl1	UTSW	19	57673141	missense	probably benign	0.07
R1183:Atrnl1	UTSW	19	57650293	missense	probably damaging	0.97
R1213:Atrnl1	UTSW	19	57638462	missense	probably benign	0.25
R1344:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1418:Atrnl1	UTSW	19	57935705	critical splice donor site	probably null
R1707:Atrnl1	UTSW	19	57686737	missense	probably benign	0.00
R1748:Atrnl1	UTSW	19	57714702	missense	probably damaging	0.99
R2051:Atrnl1	UTSW	19	57691849	missense	probably benign	0.01
R2113:Atrnl1	UTSW	19	57755616	nonsense	probably null
R2130:Atrnl1	UTSW	19	57654994	missense	probably damaging	1.00
R3710:Atrnl1	UTSW	19	57657114	missense	probably damaging	1.00
R3916:Atrnl1	UTSW	19	57935652	missense	possibly damaging	0.82
R4524:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R4707:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4712:Atrnl1	UTSW	19	57652950	missense	probably benign	0.00
R4784:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4785:Atrnl1	UTSW	19	57629158	missense	probably damaging	0.97
R4798:Atrnl1	UTSW	19	58042361	missense	probably benign
R5172:Atrnl1	UTSW	19	57685513	nonsense	probably null
R5226:Atrnl1	UTSW	19	57650335	missense	probably benign
R5289:Atrnl1	UTSW	19	57657082	missense	probably damaging	1.00
R5372:Atrnl1	UTSW	19	57755536	missense	probably benign
R5737:Atrnl1	UTSW	19	57777888	missense	possibly damaging	0.84
R5782:Atrnl1	UTSW	19	57753286	missense	possibly damaging	0.95
R5826:Atrnl1	UTSW	19	57630292	nonsense	probably null
R6169:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R6242:Atrnl1	UTSW	19	57642478	missense	probably benign	0.02
R6342:Atrnl1	UTSW	19	57638510	missense	probably damaging	1.00
R6372:Atrnl1	UTSW	19	57650332	missense	probably benign	0.01
R6811:Atrnl1	UTSW	19	57654961	missense	probably damaging	0.98
R6897:Atrnl1	UTSW	19	58042368	missense	probably benign	0.01
R7024:Atrnl1	UTSW	19	57638450	critical splice acceptor site	probably null
R7085:Atrnl1	UTSW	19	57691857	missense	probably damaging	1.00
R7144:Atrnl1	UTSW	19	58042352	missense	probably damaging	1.00
R7259:Atrnl1	UTSW	19	57935606	nonsense	probably null
R7289:Atrnl1	UTSW	19	57650414	missense	probably benign	0.13
R7310:Atrnl1	UTSW	19	57642424	missense	possibly damaging	0.69
R7372:Atrnl1	UTSW	19	57935646	missense	possibly damaging	0.47
R7432:Atrnl1	UTSW	19	57755524	missense	probably damaging	1.00
R7478:Atrnl1	UTSW	19	57696312	missense	possibly damaging	0.89
R7556:Atrnl1	UTSW	19	57654846	missense	probably benign
R7567:Atrnl1	UTSW	19	57699523	missense	probably damaging	0.98
R7608:Atrnl1	UTSW	19	57714687	missense	probably damaging	1.00
R7632:Atrnl1	UTSW	19	57630306	missense	probably damaging	1.00
R7655:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7656:Atrnl1	UTSW	19	57611379	nonsense	probably null
R7718:Atrnl1	UTSW	19	57740183	nonsense	probably null
R7721:Atrnl1	UTSW	19	57696331	missense	probably benign	0.00
R7726:Atrnl1	UTSW	19	57702072	missense	probably damaging	1.00
R7733:Atrnl1	UTSW	19	57701988	missense	probably benign	0.00
R7774:Atrnl1	UTSW	19	57699671	missense	probably damaging	1.00
R8010:Atrnl1	UTSW	19	57682446	missense	probably benign	0.14
R8119:Atrnl1	UTSW	19	57642463	missense	probably benign	0.00
R9242:Atrnl1	UTSW	19	57657228	missense	probably benign	0.07
R9265:Atrnl1	UTSW	19	57777927	missense	probably benign	0.11
R9272:Atrnl1	UTSW	19	57654988	missense	probably benign	0.00
R9480:Atrnl1	UTSW	19	57701988	missense	possibly damaging	0.61
R9526:Atrnl1	UTSW	19	57629119	missense	probably damaging	0.99
R9672:Atrnl1	UTSW	19	57630263	missense	possibly damaging	0.87
R9673:Atrnl1	UTSW	19	57611354	start codon destroyed	probably null	0.04

Predicted Primers

PCR Primer
(F):5'- TGTGAATGAACTAAGACGCGC -3'
(R):5'- TGTAGCATTGCACCCACCATC -3'

Sequencing Primer
(F):5'- CGCAGCATAAGTAACAGTGAGC -3'
(R):5'- ATCTCCACGTGGCCACTAG -3'

Posted On

2019-12-04