Incidental Mutation 'RF022:Raph1'
ID 603918
Institutional Source Beutler Lab
Gene Symbol Raph1
Ensembl Gene ENSMUSG00000026014
Gene Name Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms C730009O10Rik, lamellipodin, 9430025M21Rik, Lpd
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # RF022 (G1)
Quality Score 203.458
Status Not validated
Chromosome 1
Chromosomal Location 60521451-60606263 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) GG to GGGGG at 60528426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]
AlphaFold F2Z3U3
Predicted Effect probably benign
Transcript: ENSMUST00000027168
SMART Domains Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090293
SMART Domains Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 294 308 N/A INTRINSIC
RA 322 408 1.63e-13 SMART
PH 450 560 3.38e-11 SMART
low complexity region 581 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140485
SMART Domains Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014

DomainStartEndE-ValueType
low complexity region 201 218 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
RA 270 356 1.63e-13 SMART
PH 398 508 3.38e-11 SMART
low complexity region 529 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188511
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,634,877 (GRCm39) probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,989,553 (GRCm39) probably benign Het
Adam6b A T 12: 113,455,289 (GRCm39) E702V possibly damaging Het
Arpc3 A G 5: 122,538,489 (GRCm39) T7A probably benign Het
Bcl3 G A 7: 19,542,966 (GRCm39) P393L probably damaging Het
Ceacam9 A G 7: 16,459,304 (GRCm39) D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,527,679 (GRCm39) probably benign Het
Clgn A G 8: 84,152,235 (GRCm39) K579R probably damaging Het
Cntnap2 C T 6: 46,998,599 (GRCm39) R884W probably damaging Het
Col6a4 A T 9: 105,954,207 (GRCm39) D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
D5Ertd579e A C 5: 36,772,006 (GRCm39) I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,466,600 (GRCm39) probably benign Het
Dpagt1 G T 9: 44,243,262 (GRCm39) V266L possibly damaging Het
Ebf3 C A 7: 136,915,671 (GRCm39) probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,522,691 (GRCm39) probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,981,141 (GRCm39) probably null Het
Gab3 CTT CTTATT X: 74,043,600 (GRCm39) probably null Het
Golga4 A G 9: 118,387,057 (GRCm39) D1393G probably damaging Het
Gpc5 G A 14: 115,789,688 (GRCm39) V521I probably damaging Het
Grik1 A T 16: 87,693,225 (GRCm39) N859K Het
Insrr G A 3: 87,711,792 (GRCm39) A511T possibly damaging Het
Isx A G 8: 75,600,474 (GRCm39) D69G probably damaging Het
Kcnh8 G A 17: 53,285,267 (GRCm39) R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,339,370 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Magel2 A G 7: 62,029,841 (GRCm39) E915G unknown Het
Maml3 A G 3: 51,764,083 (GRCm39) S294P probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Mef2d A T 3: 88,075,574 (GRCm39) T486S probably benign Het
Ms4a8a A G 19: 11,053,689 (GRCm39) V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or2z8 T G 8: 72,812,468 (GRCm39) *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,006,678 (GRCm39) probably null Het
Pnma8a TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,695,352 (GRCm39) probably benign Het
Ppfibp2 T C 7: 107,296,817 (GRCm39) L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,102,467 (GRCm39) probably benign Het
Ptprh A G 7: 4,552,367 (GRCm39) F966L probably benign Het
Rad17 A G 13: 100,773,593 (GRCm39) L132S probably damaging Het
Rnf126 AGGACGAGG AG 10: 79,594,977 (GRCm39) probably null Het
Rwdd2b C T 16: 87,233,558 (GRCm39) A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,373,054 (GRCm39) probably benign Het
Six3 CGG CGGTGG 17: 85,928,784 (GRCm39) probably benign Het
Sla C T 15: 66,654,593 (GRCm39) G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,968,807 (GRCm39) probably benign Het
Tfeb GCA GCAACA 17: 48,097,019 (GRCm39) probably benign Het
Tgm5 T A 2: 120,902,092 (GRCm39) E192D probably damaging Het
Tmem123 A G 9: 7,791,414 (GRCm39) Y171C probably damaging Het
Tnrc18 G A 5: 142,759,385 (GRCm39) A999V Het
Triobp C T 15: 78,858,482 (GRCm39) P1361L probably benign Het
Ubac1 A T 2: 25,895,470 (GRCm39) W328R probably damaging Het
Ube2q1 A G 3: 89,688,200 (GRCm39) N324S probably benign Het
Zcchc2 T C 1: 105,939,472 (GRCm39) I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Other mutations in Raph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02300:Raph1 APN 1 60,565,106 (GRCm39) missense possibly damaging 0.76
IGL02900:Raph1 APN 1 60,542,022 (GRCm39) missense probably damaging 1.00
FR4976:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0048:Raph1 UTSW 1 60,539,764 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0049:Raph1 UTSW 1 60,565,058 (GRCm39) missense probably benign 0.03
R0227:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.00
R0387:Raph1 UTSW 1 60,549,655 (GRCm39) intron probably benign
R0607:Raph1 UTSW 1 60,565,028 (GRCm39) missense probably damaging 1.00
R1740:Raph1 UTSW 1 60,558,183 (GRCm39) nonsense probably null
R2274:Raph1 UTSW 1 60,537,659 (GRCm39) missense probably damaging 1.00
R3108:Raph1 UTSW 1 60,532,545 (GRCm39) missense probably benign 0.01
R3977:Raph1 UTSW 1 60,537,682 (GRCm39) missense probably benign 0.39
R4260:Raph1 UTSW 1 60,542,124 (GRCm39) missense possibly damaging 0.94
R4487:Raph1 UTSW 1 60,542,028 (GRCm39) missense possibly damaging 0.68
R4721:Raph1 UTSW 1 60,542,160 (GRCm39) unclassified probably benign
R4782:Raph1 UTSW 1 60,528,273 (GRCm39) missense probably damaging 1.00
R5027:Raph1 UTSW 1 60,535,436 (GRCm39) missense probably damaging 1.00
R5037:Raph1 UTSW 1 60,535,381 (GRCm39) splice site probably null
R5106:Raph1 UTSW 1 60,572,459 (GRCm39) missense probably damaging 1.00
R5506:Raph1 UTSW 1 60,532,657 (GRCm39) intron probably benign
R5510:Raph1 UTSW 1 60,562,105 (GRCm39) unclassified probably benign
R5587:Raph1 UTSW 1 60,537,632 (GRCm39) missense probably damaging 1.00
R5591:Raph1 UTSW 1 60,540,905 (GRCm39) unclassified probably benign
R5619:Raph1 UTSW 1 60,529,414 (GRCm39) intron probably benign
R5776:Raph1 UTSW 1 60,529,315 (GRCm39) intron probably benign
R5802:Raph1 UTSW 1 60,527,832 (GRCm39) missense possibly damaging 0.81
R6742:Raph1 UTSW 1 60,564,879 (GRCm39) missense probably damaging 0.97
R7122:Raph1 UTSW 1 60,565,136 (GRCm39) missense probably benign 0.10
R7219:Raph1 UTSW 1 60,542,032 (GRCm39) missense unknown
R7251:Raph1 UTSW 1 60,529,027 (GRCm39) missense unknown
R7254:Raph1 UTSW 1 60,538,767 (GRCm39) missense unknown
R7732:Raph1 UTSW 1 60,572,447 (GRCm39) missense possibly damaging 0.82
R7979:Raph1 UTSW 1 60,565,148 (GRCm39) missense probably benign 0.00
R7986:Raph1 UTSW 1 60,535,445 (GRCm39) missense
R8167:Raph1 UTSW 1 60,529,270 (GRCm39) missense unknown
R8168:Raph1 UTSW 1 60,538,779 (GRCm39) missense unknown
R8399:Raph1 UTSW 1 60,528,477 (GRCm39) missense unknown
R9036:Raph1 UTSW 1 60,542,124 (GRCm39) missense unknown
R9146:Raph1 UTSW 1 60,558,137 (GRCm39) critical splice donor site probably null
R9338:Raph1 UTSW 1 60,529,300 (GRCm39) missense unknown
R9381:Raph1 UTSW 1 60,540,959 (GRCm39) missense unknown
R9383:Raph1 UTSW 1 60,564,829 (GRCm39) missense unknown
R9399:Raph1 UTSW 1 60,565,154 (GRCm39) missense probably benign
R9454:Raph1 UTSW 1 60,528,753 (GRCm39) missense unknown
R9561:Raph1 UTSW 1 60,564,887 (GRCm39) missense possibly damaging 0.49
RF018:Raph1 UTSW 1 60,528,426 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- CACAACTGCCGGACTTAATG -3'
(R):5'- CAGATAGCCAGTCAGTTTCCACC -3'

Sequencing Primer
(F):5'- ACTGCCGGACTTAATGCTGGAG -3'
(R):5'- TGTGGACTCTCAGCCCCTAAAG -3'
Posted On 2019-12-04