Incidental Mutation 'RF022:Tgm5'
ID603921
Institutional Source Beutler Lab
Gene Symbol Tgm5
Ensembl Gene ENSMUSG00000053675
Gene Nametransglutaminase 5
Synonyms2310007C07Rik, TGx
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #RF022 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121046111-121085841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121071611 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 192 (E192D)
Ref Sequence ENSEMBL: ENSMUSP00000028721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028721]
Predicted Effect probably damaging
Transcript: ENSMUST00000028721
AA Change: E192D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028721
Gene: ENSMUSG00000053675
AA Change: E192D

DomainStartEndE-ValueType
Pfam:Transglut_N 11 127 1.4e-31 PFAM
TGc 275 368 1.86e-49 SMART
Pfam:Transglut_C 511 610 2.5e-23 PFAM
Pfam:Transglut_C 624 722 1.8e-27 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transglutaminase family. The encoded protein catalyzes formation of protein cross-links between glutamine and lysine residues, often resulting in stabilization of protein assemblies. This reaction is calcium dependent. Mutations in this gene have been associated with acral peeling skin syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele display normal skin barrier function and no signs of skin peeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Tgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Tgm5 APN 2 121071496 missense probably benign 0.01
IGL01148:Tgm5 APN 2 121046675 splice site probably null
IGL01284:Tgm5 APN 2 121052547 missense possibly damaging 0.94
IGL01370:Tgm5 APN 2 121053537 missense probably benign 0.03
IGL01545:Tgm5 APN 2 121052808 missense probably damaging 1.00
IGL01547:Tgm5 APN 2 121049202 splice site probably benign
IGL01998:Tgm5 APN 2 121052439 missense probably damaging 1.00
IGL02577:Tgm5 APN 2 121077603 missense probably benign 0.01
IGL02636:Tgm5 APN 2 121076796 missense probably damaging 0.99
PIT4283001:Tgm5 UTSW 2 121071585 missense possibly damaging 0.48
R0001:Tgm5 UTSW 2 121077646 missense probably damaging 1.00
R0013:Tgm5 UTSW 2 121076882 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0105:Tgm5 UTSW 2 121077012 missense probably damaging 1.00
R0117:Tgm5 UTSW 2 121075102 critical splice donor site probably null
R0145:Tgm5 UTSW 2 121077581 missense possibly damaging 0.93
R0356:Tgm5 UTSW 2 121053574 missense probably damaging 1.00
R0410:Tgm5 UTSW 2 121077558 missense possibly damaging 0.46
R0519:Tgm5 UTSW 2 121048895 missense probably damaging 1.00
R1674:Tgm5 UTSW 2 121071544 missense possibly damaging 0.60
R1773:Tgm5 UTSW 2 121077650 missense possibly damaging 0.67
R1864:Tgm5 UTSW 2 121075218 missense probably damaging 1.00
R2276:Tgm5 UTSW 2 121048823 splice site probably benign
R2511:Tgm5 UTSW 2 121076948 missense possibly damaging 0.62
R4180:Tgm5 UTSW 2 121076961 missense probably benign 0.13
R4230:Tgm5 UTSW 2 121070735 missense probably damaging 1.00
R4801:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R4802:Tgm5 UTSW 2 121052472 missense probably damaging 1.00
R5840:Tgm5 UTSW 2 121085660 critical splice donor site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R6033:Tgm5 UTSW 2 121070729 splice site probably null
R7064:Tgm5 UTSW 2 121053514 missense probably benign 0.04
R7102:Tgm5 UTSW 2 121046498 missense possibly damaging 0.89
R7114:Tgm5 UTSW 2 121048496 nonsense probably null
R7178:Tgm5 UTSW 2 121085768 start gained probably benign
R7748:Tgm5 UTSW 2 121052808 missense probably damaging 1.00
R7969:Tgm5 UTSW 2 121075169 missense probably damaging 1.00
R8428:Tgm5 UTSW 2 121048875 missense probably benign
V3553:Tgm5 UTSW 2 121071502 missense probably damaging 1.00
X0065:Tgm5 UTSW 2 121070839 missense probably damaging 1.00
Z1177:Tgm5 UTSW 2 121052451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCAGAGGTCCCTTTACAC -3'
(R):5'- GACATATATGCCAAGTGGGTTATGC -3'

Sequencing Primer
(F):5'- AGAGGTCCCTTTACACAGCTC -3'
(R):5'- CCAAGTGGGTTATGCTACCATAG -3'
Posted On2019-12-04