Mutagenetix > Incidental Mutations

Incidental Mutation 'RF022:Insrr'

603925

Institutional Source

Beutler Lab

Gene Symbol

Insrr

Ensembl Gene

ENSMUSG00000005640

Gene Name

insulin receptor-related receptor

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

RF022 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87796951-87816101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87804485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 511 (A511T)

Ref Sequence

ENSEMBL: ENSMUSP00000029711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029711] [ENSMUST00000029714] [ENSMUST00000090981] [ENSMUST00000107582]

AlphaFold

Q9WTL4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029711
AA Change: A511T

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029711
Gene: ENSMUSG00000005640
AA Change: A511T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	1.8e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	3.8e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000029714

SMART Domains

Protein: ENSMUSP00000029714
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090981

SMART Domains

Protein: ENSMUSP00000088503
Gene: ENSMUSG00000028073

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	67	78	N/A	INTRINSIC
EGF	102	130	3.82e-2	SMART
EGF_like	132	173	2.92e1	SMART
EGF_like	146	185	1.92e0	SMART
EGF_like	189	246	1.99e0	SMART
EGF	217	258	1.04e1	SMART
EGF_Lam	274	313	1.21e-4	SMART
EGF	312	344	4.03e-1	SMART
EGF_Lam	361	402	1.33e-1	SMART
EGF	401	433	1.18e-2	SMART
EGF_like	449	488	1.72e0	SMART
EGF	487	519	6.92e0	SMART
EGF_Lam	535	574	2.08e-3	SMART
EGF	573	605	5.49e-3	SMART
EGF_Lam	620	660	1.58e-3	SMART
EGF	659	691	3.1e-2	SMART
EGF	702	734	2.53e1	SMART
transmembrane domain	754	776	N/A	INTRINSIC
low complexity region	809	822	N/A	INTRINSIC
low complexity region	829	835	N/A	INTRINSIC
low complexity region	954	971	N/A	INTRINSIC
low complexity region	993	1002	N/A	INTRINSIC
low complexity region	1019	1031	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107582
AA Change: A511T

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103208
Gene: ENSMUSG00000005640
AA Change: A511T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Recep_L_domain	47	159	7.7e-25	PFAM
FU	225	268	9.54e-11	SMART
Pfam:Recep_L_domain	346	460	1.6e-28	PFAM
FN3	483	586	9.19e-1	SMART
FN3	605	798	6.45e-5	SMART
FN3	816	899	6.35e-4	SMART
TyrKc	979	1246	4.61e-128	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no anomalies in pancreatic islet morphology, beta-cell mass or pancreatic secretory function. This mutation in combination with Insr mutant mice does not affect the diabetes predisposition of Insr mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001K19Rik	GTACT	GTACTACT	12: 110,668,443		probably null	Het
Acap3	CCTGGGCTGCTG	CCTGGGCTGCTGCATACTGGGCTGCTG	4: 155,905,096		probably benign	Het
Adam6b	A	T	12: 113,491,669	E702V	possibly damaging	Het
Arpc3	A	G	5: 122,400,426	T7A	probably benign	Het
Bcl3	G	A	7: 19,809,041	P393L	probably damaging	Het
Ceacam9	A	G	7: 16,725,379	D201G	possibly damaging	Het
Chga	AGC	AGCCGC	12: 102,561,420		probably benign	Het
Clgn	A	G	8: 83,425,606	K579R	probably damaging	Het
Cntnap2	C	T	6: 47,021,665	R884W	probably damaging	Het
Col6a4	A	T	9: 106,077,008	D377E	probably damaging	Het
Cort	GCCCACTCGT	G	4: 149,125,412		probably benign	Het
D5Ertd579e	A	C	5: 36,614,662	I796M	probably damaging	Het
Dmkn	GGTGGAAGTGGTGGAAG	GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG	7: 30,767,175		probably benign	Het
Dpagt1	G	T	9: 44,331,965	V266L	possibly damaging	Het
Ebf3	C	A	7: 137,313,942		probably benign	Het
Exd2	AGCAGCCGCAGCC	AGCAGCC	12: 80,475,917		probably benign	Het
Flywch1	CACTCCTGGTGT	CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT	17: 23,762,167		probably null	Het
Gab3	CTT	CTTATT	X: 74,999,994		probably null	Het
Golga4	A	G	9: 118,557,989	D1393G	probably damaging	Het
Gpc5	G	A	14: 115,552,276	V521I	probably damaging	Het
Grik1	A	T	16: 87,896,337	N859K		Het
Isx	A	G	8: 74,873,846	D69G	probably damaging	Het
Kcnh8	G	A	17: 52,978,239	R1079H	probably benign	Het
Lkaaear1	CAGCTCCAG	CAGCTCCAGGTCGAGCTCCAG	2: 181,697,577		probably benign	Het
Lrch1	TTGGTGGTGCTGGTGG	TTGGTGG	14: 74,947,574		probably benign	Het
Magel2	A	G	7: 62,380,093	E915G	unknown	Het
Maml3	A	G	3: 51,856,662	S294P	probably damaging	Het
Mamld1	AGC	AGCCGC	X: 71,118,820		probably benign	Het
Mef2d	A	T	3: 88,168,267	T486S	probably benign	Het
Ms4a8a	A	G	19: 11,076,325	V139A	possibly damaging	Het
Ogfr	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG	2: 180,595,266		probably benign	Het
Olfr372	T	G	8: 72,058,624	*315G	probably null	Het
Pdik1l	GTTTTTGTTTT	GTTTTTGTTTTTTTTTTGTTTT	4: 134,279,367		probably null	Het
Pnmal1	TCATGATGCACCTGCTTCAACATC	TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC	7: 16,961,427		probably benign	Het
Ppfibp2	T	C	7: 107,697,610	L177P	probably damaging	Het
Ppp1r13l	ACAGGCACCCTGCTCCGGC	AC	7: 19,368,542		probably benign	Het
Ptprh	A	G	7: 4,549,368	F966L	probably benign	Het
Rad17	A	G	13: 100,637,085	L132S	probably damaging	Het
Raph1	GG	GGGGG	1: 60,489,267		probably benign	Het
Rnf126	AGGACGAGG	AG	10: 79,759,143		probably null	Het
Rwdd2b	C	T	16: 87,436,670	A181T	probably benign	Het
Sh3pxd2b	GCCTGT	GCCTGTTCCTGT	11: 32,423,054		probably benign	Het
Six3	CGG	CGGTGG	17: 85,621,356		probably benign	Het
Sla	C	T	15: 66,782,744	G231D	probably benign	Het
Tcof1	CAG	CAGTAG	18: 60,835,735		probably benign	Het
Tfeb	GCA	GCAACA	17: 47,786,094		probably benign	Het
Tgm5	T	A	2: 121,071,611	E192D	probably damaging	Het
Tmem123	A	G	9: 7,791,413	Y171C	probably damaging	Het
Tnrc18	G	A	5: 142,773,630	A999V		Het
Triobp	C	T	15: 78,974,282	P1361L	probably benign	Het
Ubac1	A	T	2: 26,005,458	W328R	probably damaging	Het
Ube2q1	A	G	3: 89,780,893	N324S	probably benign	Het
Zcchc2	T	C	1: 106,011,742	I407T	possibly damaging	Het
Zfp384	GCCCAGGCCCAGGCCCAGGCCCAG	GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG	6: 125,036,471		probably benign	Het

Other mutations in Insrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Insrr	APN	3	87813674	critical splice donor site	probably null
IGL00801:Insrr	APN	3	87813808	missense	probably damaging	1.00
IGL01628:Insrr	APN	3	87800792	nonsense	probably null
IGL01755:Insrr	APN	3	87814186	missense	probably damaging	1.00
IGL02100:Insrr	APN	3	87811620	missense	probably damaging	1.00
IGL02261:Insrr	APN	3	87800722	missense	probably damaging	1.00
IGL02366:Insrr	APN	3	87809909	missense	possibly damaging	0.91
IGL02387:Insrr	APN	3	87813127	missense	probably damaging	1.00
IGL02478:Insrr	APN	3	87809412	missense	probably benign	0.14
IGL02550:Insrr	APN	3	87804498	missense	probably damaging	1.00
IGL02555:Insrr	APN	3	87813817	missense	probably damaging	0.99
IGL02673:Insrr	APN	3	87813061	missense	possibly damaging	0.95
IGL02724:Insrr	APN	3	87809572	missense	probably benign	0.31
IGL02798:Insrr	APN	3	87810517	missense	probably damaging	1.00
IGL02969:Insrr	APN	3	87814191	nonsense	probably null
IGL03073:Insrr	APN	3	87809938	splice site	probably benign
IGL03178:Insrr	APN	3	87802541	splice site	probably null
IGL03389:Insrr	APN	3	87808731	missense	probably damaging	1.00
IGL03399:Insrr	APN	3	87809331	missense	probably null	0.99
IGL02799:Insrr	UTSW	3	87813581	missense	probably damaging	1.00
R0011:Insrr	UTSW	3	87809616	missense	possibly damaging	0.86
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0053:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R0357:Insrr	UTSW	3	87808646	splice site	probably null
R0501:Insrr	UTSW	3	87810684	missense	probably benign	0.12
R0504:Insrr	UTSW	3	87813156	missense	possibly damaging	0.69
R0522:Insrr	UTSW	3	87800872	missense	probably damaging	1.00
R0555:Insrr	UTSW	3	87814437	splice site	probably benign
R0558:Insrr	UTSW	3	87810981	missense	possibly damaging	0.77
R0599:Insrr	UTSW	3	87813133	missense	probably damaging	0.97
R1312:Insrr	UTSW	3	87800490	missense	probably damaging	1.00
R1694:Insrr	UTSW	3	87804062	missense	probably benign
R1785:Insrr	UTSW	3	87810572	splice site	probably null
R1786:Insrr	UTSW	3	87810572	splice site	probably null
R1892:Insrr	UTSW	3	87813877	missense	probably damaging	1.00
R1950:Insrr	UTSW	3	87814513	missense	probably damaging	1.00
R2080:Insrr	UTSW	3	87814291	missense	possibly damaging	0.79
R2094:Insrr	UTSW	3	87803181	missense	probably damaging	1.00
R2130:Insrr	UTSW	3	87810572	splice site	probably null
R2131:Insrr	UTSW	3	87810572	splice site	probably null
R2133:Insrr	UTSW	3	87810572	splice site	probably null
R2220:Insrr	UTSW	3	87809418	missense	probably damaging	1.00
R2259:Insrr	UTSW	3	87800452	missense	probably damaging	1.00
R2404:Insrr	UTSW	3	87802667	missense	possibly damaging	0.71
R4027:Insrr	UTSW	3	87809599	missense	probably benign
R4042:Insrr	UTSW	3	87813827	missense	probably damaging	1.00
R4510:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4511:Insrr	UTSW	3	87808671	missense	possibly damaging	0.67
R4571:Insrr	UTSW	3	87800887	missense	probably benign
R4870:Insrr	UTSW	3	87811604	missense	probably damaging	1.00
R5057:Insrr	UTSW	3	87815265	missense	probably benign	0.00
R5393:Insrr	UTSW	3	87810700	splice site	probably null
R5685:Insrr	UTSW	3	87800496	splice site	probably null
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6039:Insrr	UTSW	3	87809301	missense	possibly damaging	0.56
R6047:Insrr	UTSW	3	87804176	missense	probably damaging	1.00
R6276:Insrr	UTSW	3	87800519	nonsense	probably null
R6298:Insrr	UTSW	3	87812965	missense	probably damaging	1.00
R6726:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6727:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6728:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R6796:Insrr	UTSW	3	87813566	missense	probably damaging	1.00
R7041:Insrr	UTSW	3	87815244	missense	probably damaging	1.00
R7169:Insrr	UTSW	3	87808594	missense	probably benign	0.15
R7270:Insrr	UTSW	3	87803133	missense	probably damaging	1.00
R7340:Insrr	UTSW	3	87814316	critical splice donor site	probably null
R7398:Insrr	UTSW	3	87808732	missense	probably damaging	1.00
R7473:Insrr	UTSW	3	87804531	splice site	probably null
R7815:Insrr	UTSW	3	87808695	missense	probably damaging	0.98
R8159:Insrr	UTSW	3	87800428	missense	probably damaging	1.00
R8289:Insrr	UTSW	3	87814194	missense	probably damaging	1.00
R8309:Insrr	UTSW	3	87810442	missense	probably benign	0.00
R8312:Insrr	UTSW	3	87800484	missense	possibly damaging	0.93
R8445:Insrr	UTSW	3	87813584	missense	probably damaging	1.00
R8917:Insrr	UTSW	3	87810969	missense	probably benign	0.00
R8960:Insrr	UTSW	3	87813079	missense	probably damaging	1.00
R8989:Insrr	UTSW	3	87815357	missense	probably damaging	0.96
R9015:Insrr	UTSW	3	87813603	missense	probably damaging	1.00
R9202:Insrr	UTSW	3	87813120	missense	probably damaging	1.00
R9251:Insrr	UTSW	3	87810084	missense	probably benign	0.08
R9327:Insrr	UTSW	3	87814297	missense	probably damaging	1.00
Z1177:Insrr	UTSW	3	87800827	missense	possibly damaging	0.91
Z1192:Insrr	UTSW	3	87802579	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTAAAATACCGAGGGGATCAAC -3'
(R):5'- AATCTTTGAGAGCTGGAGGC -3'

Sequencing Primer
(F):5'- CCCAAGGGGTGAGCAGC -3'
(R):5'- GCTGGAGGCTAGTTTACATATTGAG -3'

Posted On

2019-12-04