Incidental Mutation 'RF022:Ppp1r13l'
ID603939
Institutional Source Beutler Lab
Gene Symbol Ppp1r13l
Ensembl Gene ENSMUSG00000040734
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13 like
SynonymsNFkB interacting protein 1, wa3, IASPP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #RF022 (G1)
Quality Score217.49
Status Not validated
Chromosome7
Chromosomal Location19359749-19378533 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) ACAGGCACCCTGCTCCGGC to AC at 19368542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047621] [ENSMUST00000127785] [ENSMUST00000132655] [ENSMUST00000140836]
Predicted Effect probably benign
Transcript: ENSMUST00000047621
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127785
SMART Domains Protein: ENSMUSP00000116351
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132655
SMART Domains Protein: ENSMUSP00000118309
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140836
SMART Domains Protein: ENSMUSP00000114443
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for spontaneous mutations in this gene exhibit cardiovascular defects leading to cardiomyopathy, open eyelids at birth, and coat abnormalities. One allele also shows postnatal lethality dependent on strain background and decreased weight, while another shows impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Ppp1r13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ppp1r13l APN 7 19375268 missense probably damaging 1.00
IGL01800:Ppp1r13l APN 7 19378011 unclassified probably benign
IGL02714:Ppp1r13l APN 7 19377643 missense possibly damaging 0.93
IGL03251:Ppp1r13l APN 7 19368869 splice site probably benign
R0507:Ppp1r13l UTSW 7 19375814 missense possibly damaging 0.63
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1845:Ppp1r13l UTSW 7 19368611 missense probably damaging 0.97
R1885:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R1886:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R2118:Ppp1r13l UTSW 7 19371421 missense possibly damaging 0.89
R4063:Ppp1r13l UTSW 7 19370053 missense probably benign
R4685:Ppp1r13l UTSW 7 19375383 critical splice donor site probably null
R5121:Ppp1r13l UTSW 7 19370095 missense probably damaging 1.00
R5604:Ppp1r13l UTSW 7 19375599 missense possibly damaging 0.89
R5669:Ppp1r13l UTSW 7 19373022 missense probably benign 0.00
R5911:Ppp1r13l UTSW 7 19375892 critical splice donor site probably null
R6002:Ppp1r13l UTSW 7 19377970 missense probably benign 0.22
R6058:Ppp1r13l UTSW 7 19370575 missense probably benign 0.01
R6170:Ppp1r13l UTSW 7 19370437 missense probably benign 0.13
R6171:Ppp1r13l UTSW 7 19377511 missense probably benign 0.06
R6246:Ppp1r13l UTSW 7 19369858 missense probably benign 0.00
R6418:Ppp1r13l UTSW 7 19371331 missense probably damaging 1.00
R6845:Ppp1r13l UTSW 7 19371398 missense probably damaging 0.99
R7367:Ppp1r13l UTSW 7 19370156 missense probably benign 0.36
R7381:Ppp1r13l UTSW 7 19368861 critical splice donor site probably null
R7467:Ppp1r13l UTSW 7 19371380 missense probably damaging 0.99
R7510:Ppp1r13l UTSW 7 19368801 missense possibly damaging 0.52
R8185:Ppp1r13l UTSW 7 19372938 missense probably benign 0.00
RF015:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AACTTTTCTCGGACGGGTTCAG -3'
(R):5'- AATTCGTCCACTTTGGCGGC -3'

Sequencing Primer
(F):5'- CAGAATTCTAGGCAAGCTTCTGGAC -3'
(R):5'- TGCTTCATGGCCAGTGC -3'
Posted On2019-12-04