Incidental Mutation 'RF022:Olfr372'
ID603945
Institutional Source Beutler Lab
Gene Symbol Olfr372
Ensembl Gene ENSMUSG00000069998
Gene Nameolfactory receptor 372
SynonymsGA_x6K02T2NUPS-191522-192466, MOR282-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #RF022 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location72041218-72060630 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to G at 72058624 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glycine at position 315 (*315G)
Ref Sequence ENSEMBL: ENSMUSP00000149288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
Predicted Effect probably null
Transcript: ENSMUST00000093434
AA Change: *315G
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: *315G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215324
AA Change: *315G
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Olfr372
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Olfr372 APN 8 72058076 missense probably damaging 1.00
R0126:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0128:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0130:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0132:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0152:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0230:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0244:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0256:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0257:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0294:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0316:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0318:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0391:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0479:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0604:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0624:Olfr372 UTSW 8 72058162 missense possibly damaging 0.94
R0631:Olfr372 UTSW 8 72058322 missense probably damaging 0.99
R1785:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R1786:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R2040:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
R4176:Olfr372 UTSW 8 72058184 missense probably damaging 1.00
R4782:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R4799:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R6915:Olfr372 UTSW 8 72057730 missense probably benign 0.19
R7512:Olfr372 UTSW 8 72058523 missense probably damaging 1.00
R8255:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TATTCATGTACATGGTCCCAGGC -3'
(R):5'- TGCTGGCTGAAAGCTTGAGG -3'

Sequencing Primer
(F):5'- TACATGGTCCCAGGCAGCTAC -3'
(R):5'- GAAAGCTTGAGGTAAACTTCCTGCC -3'
Posted On2019-12-04