Incidental Mutation 'RF022:Sh3pxd2b'
ID603953
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene NameSH3 and PX domains 2B
SynonymsG431001E03Rik, Fad49, Tsk4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #RF022 (G1)
Quality Score214.791
Status Not validated
Chromosome11
Chromosomal Location32347820-32428173 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCCTGT to GCCTGTTCCTGT at 32423054 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
Predicted Effect probably benign
Transcript: ENSMUST00000038753
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32403993 nonsense probably null
IGL01581:Sh3pxd2b APN 11 32387973 missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32423095 missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32387992 missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32417161 missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32411448 splice site probably benign
IGL03378:Sh3pxd2b APN 11 32381443 missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423064 small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32423065 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32423060 small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32403978 missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32423023 missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32423341 missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32415967 missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32381441 missense possibly damaging 0.90
R1748:Sh3pxd2b UTSW 11 32422203 missense possibly damaging 0.92
R1902:Sh3pxd2b UTSW 11 32423559 makesense probably null
R1977:Sh3pxd2b UTSW 11 32422138 missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32422750 missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32411505 missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32422263 missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32396479 missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32381447 missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32422812 missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32422422 missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32407570 missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32422985 missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32423302 missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32422594 missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32415978 splice site probably null
R7056:Sh3pxd2b UTSW 11 32422737 missense probably benign 0.01
R7131:Sh3pxd2b UTSW 11 32422072 missense probably damaging 1.00
R7192:Sh3pxd2b UTSW 11 32414318 missense probably damaging 1.00
R7911:Sh3pxd2b UTSW 11 32371533 missense probably damaging 1.00
R8026:Sh3pxd2b UTSW 11 32411567 missense probably damaging 1.00
R8027:Sh3pxd2b UTSW 11 32422210 missense probably benign 0.01
RF016:Sh3pxd2b UTSW 11 32423053 small insertion probably benign
RF025:Sh3pxd2b UTSW 11 32423057 small insertion probably benign
RF040:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF056:Sh3pxd2b UTSW 11 32423055 small insertion probably benign
RF063:Sh3pxd2b UTSW 11 32423051 small insertion probably benign
X0017:Sh3pxd2b UTSW 11 32414359 missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32423110 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAAGCCACCATGCTGCTG -3'
(R):5'- TCTTGGCCCACTGAGGAGTTAG -3'

Sequencing Primer
(F):5'- TGCTGGGAGCCATGACACAG -3'
(R):5'- CCCACTGAGGAGTTAGAGAGG -3'
Posted On2019-12-04