Incidental Mutation 'RF022:Chga'
ID603955
Institutional Source Beutler Lab
Gene Symbol Chga
Ensembl Gene ENSMUSG00000021194
Gene Namechromogranin A
SynonymsChrA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF022 (G1)
Quality Score217.468
Status Not validated
Chromosome12
Chromosomal Location102554969-102565028 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) AGC to AGCCGC at 102561420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021610]
Predicted Effect probably benign
Transcript: ENSMUST00000021610
SMART Domains Protein: ENSMUSP00000021610
Gene: ENSMUSG00000021194

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Granin 25 95 3e-26 PFAM
Pfam:Granin 87 463 1.7e-95 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the granin family of acidic secretory glycoproteins that are expressed in endocrine cells and neurons. The encoded preproprotein undergoes proteolytic processing to generate multiple functions peptides including pancreastatin, catestatin and serpinin. The encoded protein plays important roles in the neuroendocrine system including regulated secretion of peptide hormones and neurotransmitters. Mice lacking the encoded protein exhibit elevated blood pressure which can be rescued by transgenic expression of the human ortholog. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes and heterozygotes for one allele display hypertension, abnormal plasma and adrenal adrenaline and noradrenaline levels and, in homozygotes, partial embryonic lethality. Homozygotes for a second allele only have elevated urinary adrenaline, noradrenaline and dopamine levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Chga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chga APN 12 102562799 missense probably damaging 0.98
IGL02674:Chga APN 12 102562901 missense probably damaging 1.00
FR4589:Chga UTSW 12 102561402 small insertion probably benign
R0018:Chga UTSW 12 102558505 missense probably damaging 0.97
R0463:Chga UTSW 12 102562951 nonsense probably null
R1164:Chga UTSW 12 102563045 missense probably damaging 1.00
R1603:Chga UTSW 12 102564607 splice site probably null
R1727:Chga UTSW 12 102561437 missense possibly damaging 0.85
R1778:Chga UTSW 12 102561700 missense probably benign
R1800:Chga UTSW 12 102555905 missense probably damaging 0.99
R2071:Chga UTSW 12 102562863 missense probably damaging 1.00
R3415:Chga UTSW 12 102562784 missense probably benign 0.00
R3696:Chga UTSW 12 102561465 missense probably damaging 0.98
R5022:Chga UTSW 12 102562837 missense probably damaging 1.00
R5507:Chga UTSW 12 102562609 missense probably benign 0.39
R5959:Chga UTSW 12 102561855 missense probably benign
R7338:Chga UTSW 12 102562841 missense probably damaging 1.00
R7410:Chga UTSW 12 102562607 missense probably benign 0.00
R7694:Chga UTSW 12 102561347 missense probably benign 0.05
R8084:Chga UTSW 12 102562069 missense probably benign 0.29
R8211:Chga UTSW 12 102561419 missense possibly damaging 0.71
RF001:Chga UTSW 12 102561423 small insertion probably benign
RF002:Chga UTSW 12 102561421 small insertion probably benign
RF006:Chga UTSW 12 102561412 small insertion probably benign
RF009:Chga UTSW 12 102561420 small insertion probably benign
RF010:Chga UTSW 12 102561403 small insertion probably benign
RF014:Chga UTSW 12 102561393 small insertion probably benign
RF014:Chga UTSW 12 102561405 small insertion probably benign
RF015:Chga UTSW 12 102561420 small insertion probably benign
RF033:Chga UTSW 12 102561396 small insertion probably benign
RF035:Chga UTSW 12 102561427 small insertion probably benign
RF044:Chga UTSW 12 102561396 small insertion probably benign
RF048:Chga UTSW 12 102561403 small insertion probably benign
RF048:Chga UTSW 12 102561421 small insertion probably benign
RF049:Chga UTSW 12 102561393 small insertion probably benign
RF052:Chga UTSW 12 102561416 small insertion probably benign
RF054:Chga UTSW 12 102561423 small insertion probably benign
RF056:Chga UTSW 12 102561424 small insertion probably benign
RF058:Chga UTSW 12 102561416 small insertion probably benign
RF060:Chga UTSW 12 102561424 small insertion probably benign
RF061:Chga UTSW 12 102561413 small insertion probably benign
RF061:Chga UTSW 12 102561427 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GAACTTTCTCACATTTCCCACTAGG -3'
(R):5'- AGCTGACTTCCTGCTGTGAAG -3'

Sequencing Primer
(F):5'- GGCCTGATGGGTATAGCTGAGAG -3'
(R):5'- CTTCCTGCTGTGAAGAAGCAG -3'
Posted On2019-12-04