Incidental Mutation 'RF022:Sla'
ID603961
Institutional Source Beutler Lab
Gene Symbol Sla
Ensembl Gene ENSMUSG00000022372
Gene Namesrc-like adaptor
SynonymsSlap, Slap-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF022 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location66780819-66831829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66782744 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 231 (G231D)
Ref Sequence ENSEMBL: ENSMUSP00000131865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000100572] [ENSMUST00000164163] [ENSMUST00000168522] [ENSMUST00000168589] [ENSMUST00000171045]
Predicted Effect probably benign
Transcript: ENSMUST00000065916
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100572
AA Change: G215D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098138
Gene: ENSMUSG00000022372
AA Change: G215D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164163
AA Change: G215D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127901
Gene: ENSMUSG00000022372
AA Change: G215D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168522
AA Change: G231D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131865
Gene: ENSMUSG00000022372
AA Change: G231D

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
SH3 41 97 4.1e-4 SMART
SH2 98 182 6.67e-29 SMART
low complexity region 263 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168589
AA Change: G215D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130222
Gene: ENSMUSG00000022372
AA Change: G215D

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation in this locus affects T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Six3 CGG CGGTGG 17: 85,621,356 probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Sla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Sla APN 15 66782630 missense possibly damaging 0.59
IGL03180:Sla APN 15 66789720 missense probably benign 0.01
crimson UTSW 15 66793705 missense probably damaging 1.00
Hearst UTSW 15 66787090 missense probably damaging 1.00
R0497:Sla UTSW 15 66792249 missense probably benign 0.00
R2019:Sla UTSW 15 66782555 missense probably damaging 1.00
R2135:Sla UTSW 15 66782714 missense probably benign 0.30
R2383:Sla UTSW 15 66782676 missense probably damaging 1.00
R3442:Sla UTSW 15 66783660 missense probably benign 0.00
R4495:Sla UTSW 15 66801512 missense probably benign
R5851:Sla UTSW 15 66783723 missense probably damaging 0.98
R5935:Sla UTSW 15 66793705 missense probably damaging 1.00
R6161:Sla UTSW 15 66782598 missense probably null 0.03
R6837:Sla UTSW 15 66787090 missense probably damaging 1.00
R7196:Sla UTSW 15 66831571 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTACAAGCCAGGTCATTAATC -3'
(R):5'- GCCCACCATTGCAAGAAATG -3'

Sequencing Primer
(F):5'- AATCTTCAAAGTACTGGGGTGC -3'
(R):5'- GCTACAAAAATCTAACCTCCTT -3'
Posted On2019-12-04