Incidental Mutation 'RF022:Six3'
ID603968
Institutional Source Beutler Lab
Gene Symbol Six3
Ensembl Gene ENSMUSG00000038805
Gene Namesine oculis-related homeobox 3
SynonymsE130112M24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF022 (G1)
Quality Score207.468
Status Not validated
Chromosome17
Chromosomal Location85613608-85629302 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CGG to CGGTGG at 85621356 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]
Predicted Effect probably benign
Transcript: ENSMUST00000162695
SMART Domains Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175898
SMART Domains Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 30 71 N/A INTRINSIC
HOX 208 269 1.26e-14 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176081
SMART Domains Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805

DomainStartEndE-ValueType
low complexity region 51 92 N/A INTRINSIC
Pfam:SIX1_SD 109 223 6e-47 PFAM
HOX 229 290 6.5e-17 SMART
low complexity region 315 331 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001K19Rik GTACT GTACTACT 12: 110,668,443 probably null Het
Acap3 CCTGGGCTGCTG CCTGGGCTGCTGCATACTGGGCTGCTG 4: 155,905,096 probably benign Het
Adam6b A T 12: 113,491,669 E702V possibly damaging Het
Arpc3 A G 5: 122,400,426 T7A probably benign Het
Bcl3 G A 7: 19,809,041 P393L probably damaging Het
Ceacam9 A G 7: 16,725,379 D201G possibly damaging Het
Chga AGC AGCCGC 12: 102,561,420 probably benign Het
Clgn A G 8: 83,425,606 K579R probably damaging Het
Cntnap2 C T 6: 47,021,665 R884W probably damaging Het
Col6a4 A T 9: 106,077,008 D377E probably damaging Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
D5Ertd579e A C 5: 36,614,662 I796M probably damaging Het
Dmkn GGTGGAAGTGGTGGAAG GGTGGAAGTGGTGGAAGAGGTGGAAGTCGTGGAAGTGGTGGAAG 7: 30,767,175 probably benign Het
Dpagt1 G T 9: 44,331,965 V266L possibly damaging Het
Ebf3 C A 7: 137,313,942 probably benign Het
Exd2 AGCAGCCGCAGCC AGCAGCC 12: 80,475,917 probably benign Het
Flywch1 CACTCCTGGTGT CACTCCTGGTGTGGGGAGGCTACGTACTCACCAACTCCTGGTGT 17: 23,762,167 probably null Het
Gab3 CTT CTTATT X: 74,999,994 probably null Het
Golga4 A G 9: 118,557,989 D1393G probably damaging Het
Gpc5 G A 14: 115,552,276 V521I probably damaging Het
Grik1 A T 16: 87,896,337 N859K Het
Insrr G A 3: 87,804,485 A511T possibly damaging Het
Isx A G 8: 74,873,846 D69G probably damaging Het
Kcnh8 G A 17: 52,978,239 R1079H probably benign Het
Lkaaear1 CAGCTCCAG CAGCTCCAGGTCGAGCTCCAG 2: 181,697,577 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Magel2 A G 7: 62,380,093 E915G unknown Het
Maml3 A G 3: 51,856,662 S294P probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Mef2d A T 3: 88,168,267 T486S probably benign Het
Ms4a8a A G 19: 11,076,325 V139A possibly damaging Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr372 T G 8: 72,058,624 *315G probably null Het
Pdik1l GTTTTTGTTTT GTTTTTGTTTTTTTTTTGTTTT 4: 134,279,367 probably null Het
Pnmal1 TCATGATGCACCTGCTTCAACATC TCATGATGCACCTGCTTCAACATCGCATGATGCACCTGCTTCAACATC 7: 16,961,427 probably benign Het
Ppfibp2 T C 7: 107,697,610 L177P probably damaging Het
Ppp1r13l ACAGGCACCCTGCTCCGGC AC 7: 19,368,542 probably benign Het
Ptprh A G 7: 4,549,368 F966L probably benign Het
Rad17 A G 13: 100,637,085 L132S probably damaging Het
Raph1 GG GGGGG 1: 60,489,267 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rwdd2b C T 16: 87,436,670 A181T probably benign Het
Sh3pxd2b GCCTGT GCCTGTTCCTGT 11: 32,423,054 probably benign Het
Sla C T 15: 66,782,744 G231D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,735 probably benign Het
Tfeb GCA GCAACA 17: 47,786,094 probably benign Het
Tgm5 T A 2: 121,071,611 E192D probably damaging Het
Tmem123 A G 9: 7,791,413 Y171C probably damaging Het
Tnrc18 G A 5: 142,773,630 A999V Het
Triobp C T 15: 78,974,282 P1361L probably benign Het
Ubac1 A T 2: 26,005,458 W328R probably damaging Het
Ube2q1 A G 3: 89,780,893 N324S probably benign Het
Zcchc2 T C 1: 106,011,742 I407T possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGCCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Other mutations in Six3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Six3 APN 17 85621937 missense possibly damaging 0.78
IGL03397:Six3 APN 17 85621646 missense probably damaging 1.00
FR4304:Six3 UTSW 17 85621368 small insertion probably benign
FR4340:Six3 UTSW 17 85621356 small insertion probably benign
FR4449:Six3 UTSW 17 85621362 small insertion probably benign
FR4548:Six3 UTSW 17 85621363 small insertion probably benign
FR4589:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621357 small insertion probably benign
FR4737:Six3 UTSW 17 85621358 small insertion probably benign
FR4737:Six3 UTSW 17 85621362 small insertion probably benign
FR4737:Six3 UTSW 17 85621363 small insertion probably benign
FR4737:Six3 UTSW 17 85621365 small insertion probably benign
FR4737:Six3 UTSW 17 85621368 small insertion probably benign
FR4976:Six3 UTSW 17 85621358 small insertion probably benign
FR4976:Six3 UTSW 17 85621371 small insertion probably benign
R0238:Six3 UTSW 17 85621390 missense probably damaging 1.00
R1264:Six3 UTSW 17 85621857 missense probably damaging 0.96
R2903:Six3 UTSW 17 85623855 missense probably damaging 0.96
R2916:Six3 UTSW 17 85621633 missense probably benign 0.25
R4994:Six3 UTSW 17 85621292 missense possibly damaging 0.91
R5393:Six3 UTSW 17 85623842 missense possibly damaging 0.93
R6524:Six3 UTSW 17 85621970 missense probably damaging 1.00
RF003:Six3 UTSW 17 85621370 small insertion probably benign
RF010:Six3 UTSW 17 85621355 small insertion probably benign
RF011:Six3 UTSW 17 85621368 small insertion probably benign
RF012:Six3 UTSW 17 85621368 small insertion probably benign
RF014:Six3 UTSW 17 85621356 small insertion probably benign
RF015:Six3 UTSW 17 85621370 small insertion probably benign
RF054:Six3 UTSW 17 85621355 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATCGCTGAATCTTGACTCGG -3'
(R):5'- TTTGTTGATGGCCTCGCAC -3'

Sequencing Primer
(F):5'- GTGGGTGTCCCTTACGTCC -3'
(R):5'- CGATGTCGCCCGTCTCC -3'
Posted On2019-12-04