Incidental Mutation 'RF023:Il2'
ID 603980
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF023 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCTTGAAG to GCTTGAAGCGGGCCTTGAAG at 37179969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

DomainStartEndE-ValueType
IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

DomainStartEndE-ValueType
Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,818 (GRCm39) probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,529,841 (GRCm39) probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,891,117 (GRCm39) probably benign Het
Amot GCAACAGCAAC GC X: 144,233,999 (GRCm39) probably benign Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Arhgef5 T A 6: 43,256,407 (GRCm39) S1172T probably damaging Het
Bltp1 T TTATTATTATTATTAG 3: 37,104,909 (GRCm39) probably benign Het
Cacna2d4 G A 6: 119,245,191 (GRCm39) V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,129,712 (GRCm39) probably benign Het
Camk2b T C 11: 5,922,301 (GRCm39) T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,511,018 (GRCm39) probably benign Het
Cdhr3 G T 12: 33,110,348 (GRCm39) S312Y probably damaging Het
Cdk1 C T 10: 69,176,328 (GRCm39) G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,865,876 (GRCm39) probably benign Het
Cenpp A T 13: 49,803,620 (GRCm39) V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,218,834 (GRCm39) Het
Dnah11 T A 12: 117,918,585 (GRCm39) R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
E4f1 AGGC AGGCGGC 17: 24,674,157 (GRCm39) probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,602,073 (GRCm39) probably benign Het
Entpd2 CTT CTTT 2: 25,290,907 (GRCm39) probably null Het
Ephx2 A G 14: 66,322,378 (GRCm39) probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,522,689 (GRCm39) probably benign Het
Gabre GCTC GCTCCGTCTC X: 71,313,660 (GRCm39) probably benign Het
H13 G A 2: 152,511,589 (GRCm39) E30K probably damaging Het
Herc1 G C 9: 66,365,616 (GRCm39) G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 (GRCm39) probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,019,867 (GRCm39) probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,020,007 (GRCm39) probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,676,217 (GRCm39) probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 92,925,587 (GRCm39) probably benign Het
Lrch1 TGGTGGTG T 14: 75,185,006 (GRCm39) probably null Het
Mgam C T 6: 40,657,642 (GRCm39) T999I probably benign Het
Mrtfa T C 15: 80,900,057 (GRCm39) E740G probably damaging Het
Nek1 A G 8: 61,525,779 (GRCm39) probably null Het
Phactr2 T A 10: 13,121,178 (GRCm39) Q503H probably benign Het
Ptprd T C 4: 76,046,802 (GRCm39) Y241C probably damaging Het
Rad51ap2 T G 12: 11,508,076 (GRCm39) V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,684,952 (GRCm39) probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,694,349 (GRCm39) probably benign Het
Rnf126 AGGACGAGG AG 10: 79,594,977 (GRCm39) probably null Het
Rnpc3 A T 3: 113,413,723 (GRCm39) S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 85,682,795 (GRCm39) probably benign Het
Sec31b G T 19: 44,524,226 (GRCm39) A138D probably damaging Het
Syne1 A T 10: 5,205,482 (GRCm39) W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,593,063 (GRCm39) probably benign Het
Tmtc3 T C 10: 100,313,728 (GRCm39) H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,673,173 (GRCm39) probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,673,180 (GRCm39) probably benign Het
Vsig2 T A 9: 37,450,559 (GRCm39) probably null Het
Wnk2 T C 13: 49,300,255 (GRCm39) T152A probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCATCCTGGGGAGTTTC -3'
(R):5'- ACAGTATAAATTGCCTCCCATGC -3'

Sequencing Primer
(F):5'- CAGGTTCCTGTAATTCTGAGAAAGCG -3'
(R):5'- ATGCTGAAGAGCTGCCTATC -3'
Posted On 2019-12-04