Incidental Mutation 'RF023:Hsdl2'
ID603983
Institutional Source Beutler Lab
Gene Symbol Hsdl2
Ensembl Gene ENSMUSG00000028383
Gene Namehydroxysteroid dehydrogenase like 2
Synonyms2610207I16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF023 (G1)
Quality Score217.468
Status Not validated
Chromosome4
Chromosomal Location59581563-59618689 bp(+) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) CAGCCACAGCTGCAG to CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG at 59610644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030078] [ENSMUST00000107528]
Predicted Effect probably benign
Transcript: ENSMUST00000030078
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107528
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,855 probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,878 probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,638,918 Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,391 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,858,485 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Hsdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Hsdl2 APN 4 59596892 missense probably benign 0.26
IGL00857:Hsdl2 APN 4 59617735 missense probably benign 0.29
IGL01859:Hsdl2 APN 4 59601569 critical splice donor site probably null
IGL02822:Hsdl2 APN 4 59601379 missense possibly damaging 0.55
IGL03028:Hsdl2 APN 4 59594471 missense probably damaging 0.98
IGL03275:Hsdl2 APN 4 59617747 makesense probably null
R0217:Hsdl2 UTSW 4 59597311 missense probably damaging 1.00
R0294:Hsdl2 UTSW 4 59601408 missense probably benign 0.00
R0448:Hsdl2 UTSW 4 59606523 missense unknown
R0490:Hsdl2 UTSW 4 59612814 splice site probably benign
R1353:Hsdl2 UTSW 4 59596971 splice site probably null
R1668:Hsdl2 UTSW 4 59612697 missense probably damaging 1.00
R3933:Hsdl2 UTSW 4 59597274 missense probably damaging 1.00
R4088:Hsdl2 UTSW 4 59610636 missense unknown
R4247:Hsdl2 UTSW 4 59594417 missense probably damaging 1.00
R4449:Hsdl2 UTSW 4 59617692 missense possibly damaging 0.61
R4723:Hsdl2 UTSW 4 59593270 unclassified probably benign
R4858:Hsdl2 UTSW 4 59612812 critical splice donor site probably null
R5361:Hsdl2 UTSW 4 59592301 unclassified probably benign
R6435:Hsdl2 UTSW 4 59610668 missense unknown
R6525:Hsdl2 UTSW 4 59612696 missense probably damaging 0.99
R6536:Hsdl2 UTSW 4 59610508 critical splice acceptor site probably null
R7156:Hsdl2 UTSW 4 59617653 missense possibly damaging 0.78
R7740:Hsdl2 UTSW 4 59612724 missense probably damaging 0.99
R8087:Hsdl2 UTSW 4 59592228 missense unknown
R8434:Hsdl2 UTSW 4 59610621 missense unknown
RF005:Hsdl2 UTSW 4 59610652 small insertion probably benign
RF013:Hsdl2 UTSW 4 59610657 small insertion probably benign
RF015:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF016:Hsdl2 UTSW 4 59610643 small insertion probably benign
RF020:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF025:Hsdl2 UTSW 4 59610637 small insertion probably benign
RF026:Hsdl2 UTSW 4 59610655 small insertion probably benign
RF028:Hsdl2 UTSW 4 59610650 nonsense probably null
RF030:Hsdl2 UTSW 4 59610647 small insertion probably benign
RF038:Hsdl2 UTSW 4 59610648 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610633 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610651 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610636 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610650 small insertion probably benign
RF056:Hsdl2 UTSW 4 59610647 frame shift probably null
RF059:Hsdl2 UTSW 4 59610658 small insertion probably benign
RF060:Hsdl2 UTSW 4 59610608 small insertion probably benign
RF061:Hsdl2 UTSW 4 59610657 small insertion probably benign
Z1176:Hsdl2 UTSW 4 59617706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTATACTGCCAAAACTTTAAGGC -3'
(R):5'- GGACATAGTCTTCACCTGAGAG -3'

Sequencing Primer
(F):5'- CTGCCAAAACTTTAAGGCTCTTTATG -3'
(R):5'- GTCTTCACCTGAGAGTTCAAACTG -3'
Posted On2019-12-04