Incidental Mutation 'RF023:Arhgef5'
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene NameRho guanine nucleotide exchange factor (GEF) 5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF023 (G1)
Quality Score225.009
Status Validated
Chromosomal Location43265582-43289320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43279473 bp
Amino Acid Change Serine to Threonine at position 1172 (S1172T)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: S1172T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S1172T

Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Meta Mutation Damage Score 0.1576 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43280645 missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04