Incidental Mutation 'RF023:Cfap46'
ID603993
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF023 (G1)
Quality Score214.475
Status Not validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutation
DNA Base Change (assembly) TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC to TCTTCTCCTTCTCCTTCTCC at 139638918 bp
ZygosityHeterozygous
Amino Acid Change
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,855 probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,878 probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 probably benign Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,391 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,858,485 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Rtbdn GCAGCG GCAGCGTCAGCG 8: 84,956,166 probably benign Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers
Posted On2019-12-04