Incidental Mutation 'RF023:Rtbdn'
ID603994
Institutional Source Beutler Lab
Gene Symbol Rtbdn
Ensembl Gene ENSMUSG00000048617
Gene Nameretbindin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF023 (G1)
Quality Score214.791
Status Not validated
Chromosome8
Chromosomal Location84946991-84956603 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GCAGCG to GCAGCGTCAGCG at 84956166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065049] [ENSMUST00000067472] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000109740] [ENSMUST00000121880] [ENSMUST00000128972] [ENSMUST00000147812] [ENSMUST00000152378]
Predicted Effect probably benign
Transcript: ENSMUST00000065049
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067472
SMART Domains Protein: ENSMUSP00000070558
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 2e-40 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109736
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109740
SMART Domains Protein: ENSMUSP00000105362
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121880
SMART Domains Protein: ENSMUSP00000113982
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 27 203 3.5e-42 PFAM
low complexity region 224 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128972
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147812
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152378
SMART Domains Protein: ENSMUSP00000132841
Gene: ENSMUSG00000048617

DomainStartEndE-ValueType
Pfam:Folate_rec 2 172 2.8e-38 PFAM
low complexity region 193 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified in a study of human eye tissues. The protein encoded by this gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATTATTATTAG 3: 37,050,760 probably benign Het
5430401F13Rik ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG ACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,855 probably benign Het
5430401F13Rik AAAAACAGAAAGGAAAAGGTGGCCAG AAAAACAGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,878 probably benign Het
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
Amot GCAACAGCAAC GC X: 145,451,003 probably benign Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arhgef5 T A 6: 43,279,473 S1172T probably damaging Het
Cacna2d4 G A 6: 119,268,230 V300I probably benign Het
Calhm1 GTGGC GTGGCTGTGGCTTTGGC 19: 47,141,273 probably benign Het
Camk2b T C 11: 5,972,301 T516A probably damaging Het
Ccdc170 CCA CCAACA 10: 4,561,018 probably benign Het
Cdhr3 G T 12: 33,060,349 S312Y probably damaging Het
Cdk1 C T 10: 69,340,498 G260S possibly damaging Het
Cdsn AG AGACAGGAAGTAGTAGCTCTCAG 17: 35,554,979 probably benign Het
Cenpp A T 13: 49,650,144 V88E probably benign Het
Cfap46 TCTTCTCCCTCTCCTTCTCCTTCTCCTTCTCC TCTTCTCCTTCTCCTTCTCC 7: 139,638,918 Het
Dnah11 T A 12: 117,954,850 R3449W probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Efhd2 CCGCCG CCGCCGGCGCCG 4: 141,874,762 probably benign Het
Entpd2 CTT CTTT 2: 25,400,895 probably null Het
Ephx2 A G 14: 66,084,929 probably null Het
Exd2 GCAGCAGCCGCAGCCACAGC GCAGC 12: 80,475,915 probably benign Het
Gabre GCTC GCTCCGTCTC X: 72,270,054 probably benign Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Herc1 G C 9: 66,458,334 G324R Het
Hsdl2 CAGCCACAGCTGCAG CAGCCACAGCTGCAGCAGGAGCCACAGCTGCAG 4: 59,610,644 probably benign Het
Il2 GCTTGAAG GCTTGAAGCGGGCCTTGAAG 3: 37,125,820 probably benign Het
Krtap28-10 CAG CAGCCCTAG 1: 83,042,146 probably null Het
Krtap28-10 ACAGC ACAGCCACGGCCACCGCAGC 1: 83,042,286 probably benign Het
Krtap4-9 GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG GGCCCAGCTGCTGTGTGTCCAGCTGCTGCAGGCCCAGCTGCTGTGTGTCCAGCTGCTGCAG 11: 99,785,391 probably benign Het
Lce1m TGCTGCC TGCTGCCCCCGCCGCTGCC 3: 93,018,280 probably benign Het
Lrch1 TGGTGGTG T 14: 74,947,566 probably null Het
Mgam C T 6: 40,680,708 T999I probably benign Het
Mkl1 T C 15: 81,015,856 E740G probably damaging Het
Nek1 A G 8: 61,072,745 probably null Het
Phactr2 T A 10: 13,245,434 Q503H probably benign Het
Ptprd T C 4: 76,128,565 Y241C probably damaging Het
Rad51ap2 T G 12: 11,458,075 V666G possibly damaging Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Rfx4 CTCTCTCTCT CTCTCTCTCTCTCTCTCTGTCTCTCTCT 10: 84,858,485 probably benign Het
Rnf126 AGGACGAGG AG 10: 79,759,143 probably null Het
Rnpc3 A T 3: 113,620,074 S240T probably damaging Het
Sec31b G T 19: 44,535,787 A138D probably damaging Het
Syne1 A T 10: 5,255,482 W3495R probably damaging Het
Tgoln1 CC CCCGTGGGCTTGCCAGAATTACCTTC 6: 72,616,080 probably benign Het
Tmtc3 T C 10: 100,477,866 H48R probably benign Het
Trappc9 CTGCTGCT CTGCTGCTGCTGCTGATGCTGCT 15: 72,801,324 probably benign Het
Trappc9 T TGCTGCTGCTGCTGCC 15: 72,801,331 probably benign Het
Vsig2 T A 9: 37,539,263 probably null Het
Wnk2 T C 13: 49,146,779 T152A probably benign Het
Other mutations in Rtbdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rtbdn APN 8 84955089 missense probably damaging 1.00
IGL03192:Rtbdn APN 8 84952655 missense probably benign 0.32
FR4342:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4342:Rtbdn UTSW 8 84956178 small insertion probably benign
FR4589:Rtbdn UTSW 8 84956171 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956161 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956168 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956176 small insertion probably benign
FR4737:Rtbdn UTSW 8 84956177 small insertion probably benign
R1581:Rtbdn UTSW 8 84955066 missense probably benign 0.01
R5057:Rtbdn UTSW 8 84955009 missense probably damaging 1.00
R6788:Rtbdn UTSW 8 84952674 missense probably null 1.00
R7570:Rtbdn UTSW 8 84952927 missense probably damaging 1.00
RF024:Rtbdn UTSW 8 84956179 small insertion probably benign
RF025:Rtbdn UTSW 8 84956175 small insertion probably benign
RF034:Rtbdn UTSW 8 84956175 small insertion probably benign
RF046:Rtbdn UTSW 8 84956179 small insertion probably benign
RF050:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956170 small insertion probably benign
RF056:Rtbdn UTSW 8 84956172 small insertion probably benign
RF057:Rtbdn UTSW 8 84956166 small insertion probably benign
RF058:Rtbdn UTSW 8 84956172 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGCCATACCTAGTCCAGAAGAC -3'
(R):5'- TCGTATGGCATGGTCTAGGC -3'

Sequencing Primer
(F):5'- AGCCCAGAGACTCAGGTTC -3'
(R):5'- CATGGTCTAGGCTGGCAAC -3'
Posted On2019-12-04